Logo ZMBH Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name:  pBI-1           Size:             9492 bp


Resistance:    Ampicillin      constructed by: Udo Baron


Host strain:   DH5 alpha, E.coli "sure"


Reference:     Baron, Udo et al. (1995),Nucleic Acids Res.,17, 3605-3606


Plasmid - Map:

Plasmid-Map of pBI-1

Description :

The plasmid consists out of four main fragments:

  1. pBR322-sequences including colE1-origin of replication and ß-lactamase resistance gene with Pbla/p3 of Tn2661 (HincII and PstI-sites removed).
  2. The regulatory region with the bidirectional promotor Pbi-1:
  3. The luciferase gene luc* (Bonin, A.L. et al.,(1994),Gene ,141, 75-77) followed by SV40 late poly(A) signal and transcribed from Pmin-1
  4. The ß-galactosidase gene lacZ followed by rabbit ß-globin intron/poly(A) signal and transcribed from Pmin-2

Restriction sites :

Absent sites :


Afl II    c/ttaag          Not I     gc/ggccgc        Sap I     gcttcttc  1/4    
Age I     a/ccggt          Nru I     tcg/cga          Sfi I     ggccnnnn/nggcc   
Avr II    c/ctagg          Nsi I     atgca/t          SnaB I    tac/gta          
Eag I     c/ggccg          PaeR7 I   c/tcgag          Sse8337 I cctgca/gg        
Fse I     ggccgg/cc        Pml I     cac/gtg          Swa I     attt/aaat        
Hind III  a/agctt          Rsr II    cg/gwccg         Tth111 I  gacn/nngtc       
Nhe I     g/ctagc          Sal I     g/tcgac          Xho I     c/tcgag          

Unique sites:


  Enzyme                        Position


  Pst I     ctgca/g                1
  Stu I     agg/cct              457
  Cla I     at/cgat             1557
  EcoR V    gat/atc             1845
  Dra III   cacnnn/gtg          1919
  Bcl I     t/gatca             2080
  Eco47 III agc/gct             2567
  Acc I     gt/mkac             3497
  Sna I     gta/tac             3497
  Xca I     gta/tac             3497
  Esp I     gc/tnagc            3746
  Apa I     gggcc/c             4609
  Bsp120 I  g/ggccc             4609
  Msc I     tgg/cca             4752
  Bgl II    a/gatct             4783
  Bsa I     ggtctc    1/5       6367
  PshA I    gacnn/nngtc         7295
  Nae I     gcc/ggc             7336
  Spe I     a/ctagt             7765
  EcoN I    cctnn/nnnagg        7861
  SgrA I    cr/ccggyg           8050
  Pac I     ttaat/taa           8157
  Sph I     gcatg/c             8820
  BsaA I    yac/gtr             9327


Multiple sites:


Enzyme                   Sites       Positions

Aat II    gacgt/c          2         1353     7218
Ase I     at/taat          2         5236     6471
Asp718    g/gtacc          2          425      582
Bbe I     ggcgc/c          2         7412     9447
BsaB I    gatnn/nnatc      2         2061     7517
BspE I    t/ccgga          2         8268     8784
BstB I    tt/cgaa          2         8523     9311
BstE II   g/gtnacc         2         7379     8871
Drd I     gacnnnn/nngtc    2         2837     5509
Ehe I     ggc/gcc          2         7412     9447
Fsp I     tgc/gca          2          874     6520
Kas I     g/gcgcc          2         7412     9447
Kpn I     ggtac/c          2          425      582
Nar I     gg/cgcc          2         7412     9447
Nco I     c/catgg          2         4198     9481
Sac II    ccgc/gg          2           17      560
Sca I     agt/act          2         4360     6778
Spl I     c/gtacg          2         3505     9325
Sty I     c/cwwgg          2         4198     9481
Xmn I     gaann/nnttc      2         3817     6895

Bsm I     gaatgc    1/-1   3         7359     7604     7703
BspM I    acctgc    4/8    3         1517     3389     8072
BssH II   g/cgcgc          3         2232     7355     7458
BstX I    ccannnnn/ntgg    3         2947     3564     4755
Bsu36 I   cc/tnagg         3          957     4712     8866
EcoR I    g/aattc          3            7      570     4703
Hpa I     gtt/aac          3         1158     1782     7620
Mlu I     a/cgcgt          3         2036     2816     3241
PflM I    ccannnn/ntgg     3         1973     2339     4983
PpuM I    rg/gwccy         3         4091     7469     8300
Sma I     ccc/ggg          3          429      586      608
Xba I     t/ctaga          3          597     4062     7759
Xcm I     ccannnnn/nnnntgg 3         2944     3689     8742
Xma I     c/ccggg          3          429      586      608


Site Usage

 
 
 Aat II       2    BssH II      3    Hga I       21    Pml I        -    
 Acc I        1    BstB I       2    HgiA I      11    PpuM I       3    
 Afl II       -    BstE II      2    Hha I       53    PshA I       1    
 Afl III      7    BstK I      45    Hinc II      7    Pst I        1    
 Age I        -    BstN I      23    Hind III     -    Pvu I        4    
 Aha II      11    BstU I      48    Hinf I      20    Pvu II       4    
 Alu I       30    BstX I       3    HinP I      53    Rma I       12    
 Alw I       32    BstY I      16    Hpa I        3    Rsa I       17    
 AlwN I       5    Bsu36 I      3    Hpa II      46    Rsr II       -    
 Apa I        1    Cfr10 I      9    Hph I       17    Sac I        5    
 ApaL I       4    Cla I        1    Kas I        2    Sac II       2    
 Ase I        2    Csp6 I      17    Kpn I        2    Sal I        -    
 Asp718       2    Dde I       16    Mae II      18    Sap I        -    
 Ava I        7    Dpn I       45    Mae III     36    Sau3A I     45    
 Ava II      10    Dpn II      45    Mbo I       45    Sau96 I     24    
 Avr II       -    Dra I        7    Mbo II      30    Sca I        2    
 BamH I       4    Dra III      1    Mcr I       14    ScrF I      45    
 Ban I        9    Drd I        2    Mlu I        3    SfaN I      17    
 Ban II       8    Dsa I        9    Mme I        5    Sfe I        7    
 Bbe I        2    Dsa V       45    Mnl I       59    Sfi I        -    
 Bbs I        8    Eae I        6    Msc I        1    SgrA I       1    
 Bbv I       29    Eag I        -    Mse I       32    Sma I        3    
 BceF I      17    Ear I        8    Msp I       46    Sna I        1    
 Bcl I        1    Ecl136 I     5    Nae I        1    SnaB I       -    
 Bcn I       22    Eco47 III    1    Nar I        2    Spe I        1    
 Bgl I        6    Eco57 I      7    Nci I       22    Sph I        1    
 Bgl II       1    EcoN I       1    Nco I        2    Spl I        2    
 Bsa I        1    EcoO109 I    5    Nde I        5    Sse8337 I    -    
 BsaA I       1    EcoR I       3    Nhe I        -    Ssp I        4    
 BsaB I       2    EcoR II     23    Nla III     32    Stu I        1    
 BsaJ I      26    EcoR V       1    Nla IV      35    Sty I        2    
 Bsg I        7    Ehe I        2    Not I        -    Swa I        -    
 BsiE I      14    Esp I        1    Nru I        -    Taq I       33    
 BsiY I      21    Fau I       15    Nsi I        -    Tfi I       10    
 Bsm I        3    Fse I        -    Nsp I        5    Tth111 I     -    
 BsmA I      11    Fnu4H I     56    Nsp7524 I    5    Tth111 II    6    
 Bsp120 I     1    Fok I       27    NspB II     19    Xba I        3    
 Bsp1286 I   15    Fsp I        2    NspC I       5    Xca I        1    
 BspE I       2    Gdi II       5    Pac I        1    Xcm I        3    
 BspH I       5    Gsu I        9    PaeR7 I      -    Xho I        -    
 BspM I       3    Hae I       10    PflM I       3    Xma I        3    
 BspW I      41    Hae II      13    Ple I       10    Xmn I        2    
 Bsr I       25    Hae III     34    


Sequence :


1                                                                              80                                       CTGCAGGAATTCGGGGCCGCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCC
CTGCAGGAATTCGGGGCCGCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCC
AGGCGATCTGACGGTTCACTAAACGAGCTCTGCTTATATAGGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTG
AAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAA
AGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGA
GAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGA
TAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTT
TAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTC
CGCGGCCCCGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGGATCCCCGGGATCGAAAGAGCCTGCTAAAGCAAAAAA
GAAGTCACCATGTCGTTTACTTTGACCAACAAGAACGTGATTTTCGTTGCCGGTCTGGGAGGCATTGGTCTGGACACCAG
CAAGGAGCTGCTCAAGCGCGATCCCGTCGTTTTACAACGTCGTGACTGGGAAAAACCCTGGCGTTACCCAACTTAATCGC
CTTGCAGCACATCCCCCTTTCGCCAGCTGGCTTTATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAG
CCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTG
AGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCCCATCTACACCAACGTAACCTATTCC
ATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTG
GCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAACTTGGCGTTTCATCTGTGGTGCAACGTGCGCTGGGTCG
GTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTG
ATGGTGCTGCGTTGGAGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTC
GTTGCTGCATAAACCGACTACACAAATCAGCGATTTCCATGTTGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGAAC
TGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAG
GTCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCT
GAACGTCGAAAACCCGAAACTGTGGAGCGCCGAAATCCCGAATCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGACG
GCACGCTGATTGAAGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGC
AAGCCGTTGCTGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGTCATGGATGAGCAGACGATGGT
GCAGGATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCATTATCCGAACCATCCGCTGTGGTACA
CGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCACGGCATGGTGCCAATGAATCTGCTG
ACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGGTGCAGCGCGATCGTAATCACCCGAGTGT
GATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAATCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATC
CTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATATTATTTGCCCGATGTACGCGCGCGTG
GATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCGCT
GATCCTTTGCGAATACGCCCACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAGTATC
CCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTAAATATGATGAAAACGGCAACCCGTGGTCG
GCTTACGGCGGTGATTTTGGCGATACGCCGAACCATCGCCAGTTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCC
GCATCCAGCGCTGACGGAAGCAAAACACCAGCAGCAGTTTTTCCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCA
GCGAATACCTGTTCCGTCATAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGT
GAAGTGCCTCTGGATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGGGCA
ACTCTGGCTCACAGTACGCGTAGTGCAACCGAACGCGACCGGATGGTCAGAAGCCGGGCACATCAGCGCCTGGCAGCAGT
GGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCCGCATCTGACCACCAGCGAAATGGAT
TTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTCTTTCACAGCTGTGGATTGGCGATAA
AAAACAACTGCTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGCTGGATAACGACATTGGCGTAAGTGAAGCGACCC
GCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGCCGAAGCAGCGTTGTTGCAGTGCACG
GCAGATACACTTGCTGATGCGGTGCTGATTACGACCGCTCACGCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCG
GAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGAAGTGGCGAGCGATACACCGCATCCGG
CGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCTCGGATTAGGGCCGCAAGAAAACTAT
CCCGACCGCCTTACTGCCGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAG
CGAAAACGGTCTGCGCTGCGGGACGCGCGAATTGAATTATGGCCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCA
GCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATC
GACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGGCGGAATTACAGCTGAGCGCCGGTCG
CTACCATTACCAGTTGGTCTGGTGTCAAAAATAATAATAACCGGCAGGCCATGTCTGAAAGTATTCGCGTAAGGAAATCC
ATTATGTACTATTTAAAAAACACAAACTTTTGGATGTTCGGTTTATTCTTTTTCTTTTACTTTTTTATCATGGGAGCCTA
CTTCCCGTTTTTCCCGATTTGGCTACATGACATCAACCATATGAGCAAAAGTGATACGGGTATTATTTTTGCCGCTATTT
CTCTGTTGTCGCTATTATTCCAACCGCTGTTGGTCTGCTTTCTGACAAACTCGGCCTCGACTCTAGACTGAGAACTTCAG
GGTGAGTTTGGGGACCCTTGATTGTTCTTTCTTTTTCGCTATTGAAAAATTCATGTTATATGGAGGGGGCAAAGTTTTCA
GGGTGTTGTTTAGAATGGGAAGATGTCCCTTGTATCACCATGGACCCTCATGATAATTTTGTTTCTTTCACTTTCTACTC
TGTTGACAACCATTGTCTCCTCTTATTTTCTTTTCATTTTCTGTAACTTTTTTCGTTAAACTTTAGCTTGCATTTGTAAC
GAATTTTTAAATTCACTTTCGTTTATTTGTCAGATTGTAAGTACTTTCTCTAATCACTTTTTTTTCAAGGCAATCAGGGT
AATTATATTGTACTTCAGCACAGTTTTAGAGAACAATTGTTATAATTAAATGATAAGGTAGAATATTTCTGCATATAAAT
TCTGGCTGGCGTGGAAATATTCTTATTGGTAGAAACAACTACATCCTGGTAATCATCCTGCCTTTCTCTTTATGGTTACA
ATGATATACACTGTTTGAGATGAGGATAAAATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCT
TCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTGTTGTGCTGTCTCATCATTTTGGCAAAGAATTCACTCCTCAGGTG
CAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGGCCAATGCCCTGGCTCACAAATACCACTGAGATCTTTTTCCCTCTGC
CAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGGTAATAAAGGAAATTTATTTTCATTGCAATAG
TGTGTGGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACATCAGAATGAGTATTTG
GTTTAGAGTTTGGCAACATATGCCATATGCTGGCTGCCATGAACAAAGGTGGCTATAAAGAGGTCATCAGTATATGAAAC
AGCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGACTTGAGGTTAGATTTTTTTTATATTTTGTTTTGTGTTA
TTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTTTCCTCCTCTCCTGACTACTCCCAGT
CATAGCTGTCCCTCTTCTCTTATGAACTCGACTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTG
GGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAG
GCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAA
CCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTC
AGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCG
ACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTA
TCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTAT
CCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGC
AGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGG
TATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTA
GCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACG
GGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGAT
CCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAA
TCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACG
ATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGC
AATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTT
GCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCA
CGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAA
AAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAG
CACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGA
GAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAA
AGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAAC
CCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAAT
GCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTA
TCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTC
CCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCC
TTTCGTCTTCACTCGACGCTGGTCGAGCTGATACTTCCCGTCCGCCAGGGGACATGCCGGCGATGCTGAAGGTCGCGCGC
ATTCCCGATGAAGAGGCCGGTTACCGCCTGTTGACCTGGTGGGACGGGCAGGGCGCCGCCCGAGTCTTGCCTCGGCGGCG
GGCGCTCTGCTCATGGAGCGCGCGTCCGGGGACCTTGCACAGATAGCGTGGTCCGGCCAGACGACGAGGCTTGCAGGATC
ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAA
AATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCA
CAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCCTC
TAGAACTAGTGGATCCCCCCTAGAGTATTACAATAGCTAAGAATTTCGTCATCGCTGAATACAGTTACATTTTACAATTT
GGACTTTCCGCCCTTCTTGGCCTTTATGAGGATCTCTCTGATTTTTCTTGCGTCGAGTTTTCCGGTAAGACCTTTCGGTA
CTTCGTCCACAAACACAACTCCTCCGCGCAACTTTTTGGCGGTTGTTACTTGACTGGCGACGTAATCCACGATCTCTTTT
TCCGTCATCGTCTTTCCGTGCTCCAAAACAACAACGGCGGCGGGAAGTTCACCGGCGTCATCGTCGGGAAGACCTGCCAC
GCCCGCGTCGAAGATGTTGGGGTGTTGTAACAATATCGACTCCAATTCAGCGGGGGCCACCTGGTATCCTTTGTATTTAA
TTAAAGACTTCAAGCGGTCAACTATGAAGAAGTGTTCGTCTTCGTCCCAGTAAGCTATGTCTCCAGAATGTAGCCATCCA
TCCTTGTCAATCAAGGCGTTGGTCGCTTCCGGATTGTTTACATAACCGGACATAATCATAGGTCCTCTGACACATAATTC
GCCTCTCTGATTAACGCCCAGCGTTTTCCCGGTATCCAGATCCACAACCTTCGCTTCAAAAAATGGAACAACTTTACCGA
CCGCGCCCGGTTTATCATCCCCCTCGGGTGTAATCAGAATAGCTGATGTAGTCTCAGTGAGCCCATATCCTTGTCGTATC
CCTGGAAGATGGAAGCGTTTTGCAACCGCTTCCCCGACTTCTTTCGAAAGAGGTGCGCCCCCAGAAGCAATTTCGTGTAA
ATTAGATAAATCGTATTTGTCAATCAGAGTGCTTTTGGCGAAGAATGAAAATAGGGTTGGTACTAGCAACGCACTTTGAA
TTTTGTAATCCTGAAGGGATCGTAAAAACAGCTCTTCTTCAAATCTATACATTAAGACGACTCGAAATCCACATATCAAA
TATCCGAGTGTAGTAAACATTCCAAAACCGTGATGGAATGGAACAACACTTAAAATCGCAGTATCCGGAATGATTTGATT
GCCAAAAATAGGATCTCTGGCATGCGAGAATCTGACGCAGGCAGTTCTATGCGGAAGGGCCACACCCTTAGGTAACCCAG
TAGATCCAGAGGAGTTCATTATCAGTGCAATTGTTTTGTCACGATCAAAGGACTCTGGTACAAAATCGTATTCATTAAAA
CCGGGAGGTAGATGAGATGTGACGAACGTGTACATCGACTGAAATCCCTGGTAATCCGTTTTAGAATCCATGATAATAAT
TTTCTGGATTATTGGTAATTTTTTTTGCACGTTCAAAATTTTTTGCAACCCCTTTTTGGAAACAAACACTACGGTAGGCT
GCGAAATGTTCATACTGTTGAGCAATTCACGTTCATTATAAATGTCGTTCGCGGGCGCAACTGCAACTCCGATAAATAAC
GCGCCCAACACCGGCATAAAGAATTGAAGAGAGTTTTCACTGCATACGACGATTCTGTGATTTGTATTCAGCCCATATCG
TTTCATAGCTTCTGCCAACCGAACGGACATTTCGAAGTATTCCGCGTACGTGATGTTCACCTCGATATGTGCATCTGTAA
AAGCAATTGTTCCAGGAACCAGGGCGTATCTCTTCATAGCCTTATGCAGTTGCTCTCCAGCGGTTCCATCCTCTAGCGGA
TAGAATGGCGCCGGGCCTTTCTTTATGTTTTTGGCGTCTTCCATGGTACGGG