Logo ZMBH Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name:  pBI-3           Size:             7727 bp


Resistance:    Ampicillin      constructed by: Udo Baron, Rolf Sprengel
                                                             

Host strain:   DH5 alpha, E.coli "sure"


Reference:     Baron, Udo et al. (1995),Nucleic Acids Res.,17, 3605-3606


Plasmid - Map:

Plasmid-Map of pBI-3

Description :

The plasmid consists out of four main fragments:

  1. pBR322-sequences including colE1-origin of replication and ß-lactamase resistance gene with Pbla/p3 of Tn2661 (HincII and PstI-sites removed).
  2. The regulatory region with the bidirectional promotor Pbi-1:
  3. The ß-galactosidase gene lacZ followed by rabbit ß-globin intron/poly(A) signal and transcribed from Pmin-2.lacZ is fused at the 5Ģend to the sequence encoding SV40 nuclear transport signal (Lanford et al.,Mol. Cell. Biol., 8
  4. Multible cloning site 2, followed by SV40 late poly(A) signal and transcribed from Pmin-1. Cleavage specificities of MCS 2 are Sal I, Not I, Pst I

Restriction sites :

Absent sites :


Afl II    c/ttaag          Nhe I     g/ctagc          SgrA I    cr/ccggyg        
Age I     a/ccggt          Nru I     tcg/cga          SnaB I    tac/gta          
Avr II    c/ctagg          Nsi I     atgca/t          Spe I     a/ctagt          
BsaA I    yac/gtr          Pac I     ttaat/taa        Sph I     gcatg/c          
BspE I    t/ccgga          PaeR7 I   c/tcgag          Sse8337 I cctgca/gg        
BstB I    tt/cgaa          Pml I     cac/gtg          Swa I     attt/aaat        
EcoN I    cctnn/nnnagg     Rsr II    cg/gwccg         Tth111 I  gacn/nngtc       
Fse I     ggccgg/cc        Sap I     gcttcttc  1/4    Xho I     c/tcgag          
Hind III  a/agctt          Sfi I     ggccnnnn/nggcc   

Unique sites:


  Enzyme                        Position


  Pst I     ctgca/g                1
  Stu I     agg/cct              457
  Cla I     at/cgat             1502
  EcoR V    gat/atc             1790
  Dra III   cacnnn/gtg          1864
  Bcl I     t/gatca             2025
  Eco47 III agc/gct             2512
  Sna I     gta/tac             3442
  Xca I     gta/tac             3442
  Spl I     c/gtacg             3450
  Esp I     gc/tnagc            3691
  Msc I     tgg/cca             4697
  Bgl II    a/gatct             4728
  Bsa I     ggtctc    1/5       6312
  PshA I    gacnn/nngtc         7240
  Nae I     gcc/ggc             7281
  BstE II   g/gtnacc            7324
  Bbe I     ggcgc/c             7357
  Ehe I     ggc/gcc             7357
  Kas I     g/gcgcc             7357
  Nar I     gg/cgcc             7357
  Sal I     g/tcgac             7715
  Not I     gc/ggccgc           7721
  Eag I     c/ggccg             7722


Multiple sites:


Enzyme                   Sites       Positions


Aat II    gacgt/c          2         1298     7163
Acc I     gt/mkac          2         3442     7715
Apa I     gggcc/c          2          650     4554
Ase I     at/taat          2         5181     6416
Asp718    g/gtacc          2          425      582
BsaB I    gatnn/nnatc      2         2006     7462
Bsp120 I  g/ggccc          2          650     4554
BspM I    acctgc    4/8    2         1462     3334
Bsu36 I   cc/tnagg         2          902     4657
Drd I     gacnnnn/nngtc    2         2782     5454
Fsp I     tgc/gca          2          819     6465
Kpn I     ggtac/c          2          425      582
Nco I     c/catgg          2          645     4143
PpuM I    rg/gwccy         2         4036     7414
Sac II    ccgc/gg          2           17      560
Sca I     agt/act          2         4305     6723
Sma I     ccc/ggg          2          429      586
Sty I     c/cwwgg          2          645     4143
Xcm I     ccannnnn/nnnntgg 2         2889     3634
Xma I     c/ccggg          2          429      586
Xmn I     gaann/nnttc      2         3762     6840

Bsm I     gaatgc    1/-1   3         7304     7549     7648
BssH II   g/cgcgc          3         2177     7300     7403
BstX I    ccannnnn/ntgg    3         2892     3509     4700
Hpa I     gtt/aac          3         1103     1727     7565
Mlu I     a/cgcgt          3         1981     2761     3186
PflM I    ccannnn/ntgg     3         1918     2284     4928
Xba I     t/ctaga          3          597     4007     7704



Site Usage:

 
 Aat II       2    BssH II      3    Hga I       17    Pml I        -    
 Acc I        2    BstB I       -    HgiA I      10    PpuM I       2    
 Afl II       -    BstE II      1    Hha I       46    PshA I       1    
 Afl III      6    BstK I      35    Hinc II      7    Pst I        1    
 Age I        -    BstN I      18    Hind III     -    Pvu I        5    
 Aha II       8    BstU I      42    Hinf I      15    Pvu II       4    
 Alu I       24    BstX I       3    HinP I      46    Rma I        9    
 Alw I       27    BstY I      13    Hpa I        3    Rsa I       12    
 AlwN I       5    Bsu36 I      2    Hpa II      35    Rsr II       -    
 Apa I        2    Cfr10 I      6    Hph I       14    Sac I        5    
 ApaL I       4    Cla I        1    Kas I        1    Sac II       2    
 Ase I        2    Csp6 I      12    Kpn I        2    Sal I        1    
 Asp718       2    Dde I       14    Mae II      11    Sap I        -    
 Ava I        5    Dpn I       38    Mae III     29    Sau3A I     38    
 Ava II       9    Dpn II      38    Mbo I       38    Sau96 I     22    
 Avr II       -    Dra I        7    Mbo II      20    Sca I        2    
 BamH I       5    Dra III      1    Mcr I       15    ScrF I      35    
 Ban I        8    Drd I        2    Mlu I        3    SfaN I      16    
 Ban II       8    Dsa I        9    Mme I        5    Sfe I        7    
 Bbe I        1    Dsa V       35    Mnl I       47    Sfi I        -    
 Bbs I        5    Eae I        7    Msc I        1    SgrA I       -    
 Bbv I       27    Eag I        1    Mse I       26    Sma I        2    
 BceF I      16    Ear I        5    Msp I       35    Sna I        1    
 Bcl I        1    Ecl136 I     5    Nae I        1    SnaB I       -    
 Bcn I       17    Eco47 III    1    Nar I        1    Spe I        -    
 Bgl I        6    Eco57 I      6    Nci I       17    Sph I        -    
 Bgl II       1    EcoN I       -    Nco I        2    Spl I        1    
 Bsa I        1    EcoO109 I    5    Nde I        5    Sse8337 I    -    
 BsaA I       -    EcoR I       4    Nhe I        -    Ssp I        4    
 BsaB I       2    EcoR II     18    Nla III     30    Stu I        1    
 BsaJ I      21    EcoR V       1    Nla IV      34    Sty I        2    
 Bsg I        7    Ehe I        1    Not I        1    Swa I        -    
 BsiE I      15    Esp I        1    Nru I        -    Taq I       27    
 BsiY I      18    Fau I       11    Nsi I        -    Tfi I        7    
 Bsm I        3    Fse I        -    Nsp I        4    Tth111 I     -    
 BsmA I      10    Fnu4H I     55    Nsp7524 I    4    Tth111 II    4    
 Bsp120 I     2    Fok I       23    NspB II     18    Xba I        3    
 Bsp1286 I   14    Fsp I        2    NspC I       4    Xca I        1    
 BspE I       -    Gdi II       6    Pac I        -    Xcm I        2    
 BspH I       5    Gsu I        7    PaeR7 I      -    Xho I        -    
 BspM I       2    Hae I        9    PflM I       3    Xma I        2    
 BspW I      39    Hae II      13    Ple I        8    Xmn I        2    
 Bsr I       23    Hae III     32    



Sequence :


1                                                                              80                                       CTGCAGGAATTCGGGGCCGCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCC
CTGCAGGAATTCGGGGCCGCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCC
AGGCGATCTGACGGTTCACTAAACGAGCTCTGCTTATATAGGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTG
AAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAA
AGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGA
GAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGA
TAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTT
TAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTC
CGCGGCCCCGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGATCGACGGATCCGGGGAATTCCCCAGTCTCAGGA
TCCACCATGGGGCCCAAGAAGAAACGCAAAGTGGGGAGCATGGGGGATCCCGTCGTTTTACAACGTCGTGACTGGGAAAA
CCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCG
ATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGAAGCGGTGCCGGAA
AGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACGGTTACGATGCGCC
CATCTACACCAACGTAACCTATCCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACGGGTTGTTACTCGC
TCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAACTCGGCGTTTCAT
CTGTGGTGCAACGGGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGAGCGCATTTTTACG
CGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGTTGGAGTGACGGCAGTTATCTGGAAGATCAGGATATGTGGCGGA
TGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGACTACACAAATCAGCGATTTCCATGTTGCCACTCGCTTT
AATGATGATTTCAGCCGCGCTGTACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCGTGACTACCTACGGGTAACAGT
TTCTTTATGGCAGGGTGAAACGCAGGTCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAATTATCGATGAGCGTGGTGGTT
ATGCCGATCGCGTCACACTACGTCTGAACGTCGAAAACCCGAAACTGTGGAGCGCCGAAATCCCGAATCTCTATCGTGCG
GTGGTTGAACTGCACACCGCCGACGGCACGCTGATTGAAGCAGAAGCCTGCGATGTCGGTTTCCGCGAGGTGCGGATTGA
AAATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGCTGATTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTC
AGGTCATGGATGAGCAGACGATGGTGCAGGATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGTGCGCTGTTCGCAT
TATCCGAACCATCCGCTGTGGTACACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCAATATTGAAACCCA
CGGCATGGTGCCAATGAATCTGCTGACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACGCGTAACGCGAATGGTGC
AGCGCGATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAATCACGACGCGCTG
TATCGCTGGATCAAATCTGTCGATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGACACCACGGCCACCGATAT
TATTTGCCCGATGTACGCGCGCGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGTCCATCAAAAAATGGCTTT
CGCTACCTGGAGAGACGCGCCCGCTGATCCTTTGCGAATACGCCCACGCGATGGGTAACAGTCTTGGCGGTTTCGCTAAA
TACTGGCAGGCGTTTCGTCAGTATCCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGGATCAGTCGCTGATTAAATA
TGATGAAAACGGCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCGAACCATCGCCAGTTCTGTATGAACG
GTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAAACACCAGCAGCAGTTTTTCCAGTTCCGTTTA
TCCGGGCAAACCATCGAAGTGACCAGCGAATACCTGTTCCGTCATAGCGATAACGAGCTCCTGCACTGGATGGTGGCGCT
GGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCTCTGGATGTCGCTCCACAAGGTAAACAGTTGATTGAACTGCCTGAAC
TACCGCAGCCGGAGAGCGCCGGGCAACTCTGGCTCACAGTACGCGTAGTGCAACCGAACGCGACCGGATGGTCAGAAGCC
GGGCACATCAGCGCCTGGCAGCAGTGGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGTCCCACGCCATCCC
GCATCTGACCACCAGCGAAATGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGCCAGTCAGGCTTTC
TTTCACAGCTGTGGATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGTTCACCCGTGCACCGCTGGATAAC
GACATTGGCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGGGCCATTACCAGGC
CGAAGCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGATGCGGTGCTGATTACGACCGCTCACGCGTGGCAGCATC
AGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTACCGTTGATGTTGAA
GTGGCGAGCGATACACCGCATCCGGCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCAGAGCGGGTAAACTGGCT
CGGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCGCTGGGATCTGCCATTGTCAGACA
TGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGCGCGAATTGAATTATGGCCCACACCAGTGG
CGCGGCGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATCGCCATCTGCTGCACGC
GGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATCGG
CGGAATTACAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAATAATAACCGGCAGGCCATGTC
TGAAAGTATTCGCGTAAGGAAATCCATTATGTACTATTTAAAAAACACAAACTTTTGGATGTTCGGTTTATTCTTTTTCT
TTTACTTTTTTATCATGGGAGCCTACTTCCCGTTTTTCCCGATTTGGCTACATGACATCAACCATATGAGCAAAAGTGAT
ACGGGTATTATTTTTGCCGCTATTTCTCTGTTGTCGCTATTATTCCAACCGCTGTTGGTCTGCTTTCTGACAAACTCGGC
CTCGACTCTAGACTGAGAACTTCAGGGTGAGTTTGGGGACCCTTGATTGTTCTTTCTTTTTCGCTATTGAAAAATTCATG
TTATATGGAGGGGGCAAAGTTTTCAGGGTGTTGTTTAGAATGGGAAGATGTCCCTTGTATCACCATGGACCCTCATGATA
ATTTTGTTTCTTTCACTTTCTACTCTGTTGACAACCATTGTCTCCTCTTATTTTCTTTTCATTTTCTGTAACTTTTTTCG
TTAAACTTTAGCTTGCATTTGTAACGAATTTTTAAATTCACTTTCGTTTATTTGTCAGATTGTAAGTACTTTCTCTAATC
ACTTTTTTTTCAAGGCAATCAGGGTAATTATATTGTACTTCAGCACAGTTTTAGAGAACAATTGTTATAATTAAATGATA
AGGTAGAATATTTCTGCATATAAATTCTGGCTGGCGTGGAAATATTCTTATTGGTAGAAACAACTACATCCTGGTAATCA
TCCTGCCTTTCTCTTTATGGTTACAATGATATACACTGTTTGAGATGAGGATAAAATACTCTGAGTCCAAACCGGGCCCC
TCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTGTTGTGCTGTCTCATCATTT
TGGCAAAGAATTCACTCCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGGCCAATGCCCTGGCTCACAAAT
ACCACTGAGATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGGTAATAA
AGGAAATTTATTTTCATTGCAATAGTGTGTGGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCA
TTTAAAACATCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCATATGCTGGCTGCCATGAACAAAGGTGGCTA
TAAAGAGGTCATCAGTATATGAAACAGCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGACTTGAGGTTAGAT
TTTTTTTATATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTT
TCCTCCTCTCCTGACTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGAACTCGACTGCATTAATGAATCGGCCAACGC
GCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCG
GCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAG
CAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAG
CATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAG
CTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGC
TTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCC
GTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGC
AGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACG
GCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGA
TCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCA
AGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGAT
TATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACT
TGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTG
ACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCAC
GCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCC
GCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGC
CATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAG
TTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCA
GTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGG
TGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATA
CCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCG
CTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGG
GTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCC
TTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAA
CAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTA
TAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCACTCGACGCTGGTCGAGCTGATACTTCCCGTCCGCCAGGGGACAT
GCCGGCGATGCTGAAGGTCGCGCGCATTCCCGATGAAGAGGCCGGTTACCGCCTGTTGACCTGGTGGGACGGGCAGGGCG
CCGCCCGAGTCTTGCCTCGGCGGCGGGCGCTCTGCTCATGGAGCGCGCGTCCGGGGACCTTGCACAGATAGCGTGGTCCG
GCCAGACGACGAGGCTTGCAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCAC
ACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAA
TAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAA
TGTATCTTATCATGTCTGGATCCTCTAGAACTAGGTCGACGCGGCCG