Logo ZMBH Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name:  pBI-4           Size:             4358 bp


Resistance:    Ampicillin      constructed by: Udo Baron, Sabine Freundlieb
                                                   Stefan Berger

Host strain:   DH5 alpha, E.coli "sure"


Reference:     Baron, Udo et al. (1995),Nucleic Acids Res.,17, 3605-3606


Plasmid - Map:

Plasmid-Map of pBI-4

Description :

The plasmid consists out of four main fragments:

  1. pBR322-sequences including colE1-origin of replication and ß-lactamase resistance gene with Pbla/p3 of Tn2661 (HincII and PstI-sites removed).
  2. The regulatory region with the bidirectional promotor Pbi-1:
  3. Multible cloning site 1, followed by rabbit ß-globin intron/poly(A) signal and transcribed from Pmin-2. Cleavage specificities of MCS 1 are Pvu II, Mlu I, Nhe I, Eco RV.
  4. Multible cloning site 2, followed by SV40 late poly(A) signal and transcribed from Pmin-1. Cleavage specificities of MCS 2 are Sal I, Not I, Pst I

Restriction sites :

Absent sites :


Afl II    c/ttaag          Esp I     gc/tnagc         Sna I     gta/tac          
Age I     a/ccggt          Fse I     ggccgg/cc        SnaB I    tac/gta          
Avr II    c/ctagg          Hind III  a/agctt          Spe I     a/ctagt          
Bcl I     t/gatca          Nru I     tcg/cga          Sph I     gcatg/c          
BsaA I    yac/gtr          Nsi I     atgca/t          Spl I     c/gtacg          
BspE I    t/ccgga          Pac I     ttaat/taa        Sse8337 I cctgca/gg        
BspM I    acctgc    4/8    PaeR7 I   c/tcgag          Swa I     attt/aaat        
BstB I    tt/cgaa          Pml I     cac/gtg          Tth111 I  gacn/nngtc       
Cla I     at/cgat          Rsr II    cg/gwccg         Xca I     gta/tac          
Dra III   cacnnn/gtg       Sap I     gcttcttc  1/4    Xcm I     ccannnnn/nnnntgg 
Eco47 III agc/gct          Sfi I     ggccnnnn/nggcc   Xho I     c/tcgag          
EcoN I    cctnn/nnnagg     SgrA I    cr/ccggyg        

Unique sites:


  Enzyme                        Position


  Pst I     ctgca/g                1
  Stu I     agg/cct              457
  Pvu II    cag/ctg              603
  Mlu I     a/cgcgt              609
  Nhe I     g/ctagc              615
  EcoR V    gat/atc              632
  Nco I     c/catgg              774
  Sty I     c/cwwgg              774
  Apa I     gggcc/c             1185
  Bsp120 I  g/ggccc             1185
  Bsu36 I   cc/tnagg            1288
  Bsg I     gtgcag   16/14      1294
  Msc I     tgg/cca             1328
  BstX I    ccannnnn/ntgg       1331
  Bgl II    a/gatct             1359
  PflM I    ccannnn/ntgg        1559
  Drd I     gacnnnn/nngtc       2085
  BceF I    acggc    12/13      2469
  Bsa I     ggtctc    1/5       2943
  Fsp I     tgc/gca             3096
  Pvu I     cgat/cg             3243
  Xmn I     gaann/nnttc         3471
  Aat II    gacgt/c             3794
  PshA I    gacnn/nngtc         3871
  Nae I     gcc/ggc             3912
  BstE II   g/gtnacc            3955
  Bbe I     ggcgc/c             3988
  Ehe I     ggc/gcc             3988
  Kas I     g/gcgcc             3988
  Nar I     gg/cgcc             3988
  BsaB I    gatnn/nnatc         4093
  Hpa I     gtt/aac             4196
  Acc I     gt/mkac             4346
  Sal I     g/tcgac             4346
  Not I     gc/ggccgc           4352
  Eag I     c/ggccg             4353


Multiple sites:


Enzyme                   Sites       Positions


AlwN I    cagnnn/ctg       2         1228     2394
ApaL I    g/tgcac          2         2297     3543
Ase I     at/taat          2         1812     3047
Asp718    g/gtacc          2          425      582
BamH I    g/gatcc          2          591     4329
BssH II   g/cgcgc          2         3931     4034
Fau I     cccgc     4/6    2         1832     4014
Kpn I     ggtac/c          2          425      582
Mme I     tccrac   20/18   2         2173     2357
PpuM I    rg/gwccy         2          667     4045
Sac II    ccgc/gg          2           17      560
Sca I     agt/act          2          936     3354
Sma I     ccc/ggg          2          429      586
Tfi I     g/awtc           2         1818     1958
Xba I     t/ctaga          2          638     4335
Xma I     c/ccggg          2          429      586

Afl III   a/crygt          3          609     1729     1983
Ava I     c/ycgrg          3          429      586     3995
Bbs I     gaagac    2/6    3           42      535     3861
Bsm I     gaatgc    1/-1   3         3935     4180     4279
Cfr10 I   r/ccggy          3         2956     3912     3952
Dsa I     c/crygg          3           17      560      774
EcoR I    g/aattc          3            7      570     1279
Gsu I     ctggag   16/14   3           77      500     2961
Nde I     ca/tatg          3         1493     1553     1560
Nsp I     rcatg/y          3         1729     1983     3908
Nsp7524 I r/catgy          3         1729     1983     3908
NspC I    rcatg/y          3         1729     1983     3908
Ssp I     aat/att          3         1038     1072     3678



Site Usage:

 
 Aat II       1    BssH II      2    Hga I        9    Pml I        -    
 Acc I        1    BstB I       -    HgiA I       7    PpuM I       2    
 Afl II       -    BstE II      1    Hha I       19    PshA I       1    
 Afl III      3    BstK I      21    Hinc II      4    Pst I        1    
 Age I        -    BstN I      10    Hind III     -    Pvu I        1    
 Aha II       5    BstU I      16    Hinf I       7    Pvu II       1    
 Alu I       17    BstX I       1    HinP I      19    Rma I       10    
 Alw I       15    BstY I       9    Hpa I        1    Rsa I        6    
 AlwN I       2    Bsu36 I      1    Hpa II      18    Rsr II       -    
 Apa I        1    Cfr10 I      3    Hph I        7    Sac I        4    
 ApaL I       2    Cla I        -    Kas I        1    Sac II       2    
 Ase I        2    Csp6 I       6    Kpn I        2    Sal I        1    
 Asp718       2    Dde I        9    Mae II       5    Sap I        -    
 Ava I        3    Dpn I       21    Mae III     13    Sau3A I     21    
 Ava II       8    Dpn II      21    Mbo I       21    Sau96 I     15    
 Avr II       -    Dra I        6    Mbo II      13    Sca I        2    
 BamH I       2    Dra III      -    Mcr I        5    ScrF I      21    
 Ban I        4    Drd I        1    Mlu I        1    SfaN I       7    
 Ban II       5    Dsa I        3    Mme I        2    Sfe I        5    
 Bbe I        1    Dsa V       21    Mnl I       37    Sfi I        -    
 Bbs I        3    Eae I        5    Msc I        1    SgrA I       -    
 Bbv I       12    Eag I        1    Mse I       17    Sma I        2    
 BceF I       1    Ear I        4    Msp I       18    Sna I        -    
 Bcl I        -    Ecl136 I     4    Nae I        1    SnaB I       -    
 Bcn I       11    Eco47 III    -    Nar I        1    Spe I        -    
 Bgl I        4    Eco57 I      5    Nci I       11    Sph I        -    
 Bgl II       1    EcoN I       -    Nco I        1    Spl I        -    
 Bsa I        1    EcoO109 I    4    Nde I        3    Sse8337 I    -    
 BsaA I       -    EcoR I       3    Nhe I        1    Ssp I        3    
 BsaB I       1    EcoR II     10    Nla III     19    Stu I        1    
 BsaJ I      12    EcoR V       1    Nla IV      22    Sty I        1    
 Bsg I        1    Ehe I        1    Not I        1    Swa I        -    
 BsiE I       5    Esp I        -    Nru I        -    Taq I       17    
 BsiY I       6    Fau I        2    Nsi I        -    Tfi I        2    
 Bsm I        3    Fse I        -    Nsp I        3    Tth111 I     -    
 BsmA I       7    Fnu4H I     25    Nsp7524 I    3    Tth111 II    4    
 Bsp120 I     1    Fok I        8    NspB II      7    Xba I        2    
 Bsp1286 I    8    Fsp I        1    NspC I       3    Xca I        -    
 BspE I       -    Gdi II       4    Pac I        -    Xcm I        -    
 BspH I       5    Gsu I        3    PaeR7 I      -    Xho I        -    
 BspM I       -    Hae I        5    PflM I       1    Xma I        2    
 BspW I      20    Hae II       4    Ple I        5    Xmn I        1    
 Bsr I        9    Hae III     18    



Sequence :


1                                                                              80                                       
CTGCAGGAATTCGGGGCCGCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCC
AGGCGATCTGACGGTTCACTAAACGAGCTCTGCTTATATAGGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTG
AAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAA
AGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGA
GAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGA
TAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTT
TAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTC
CGCGGCCCCGAATTCGAGCTCGGTACCCGGGGATCCTCTAGTCAGCTGACGCGTGCTAGCGCGGCCTCGACGATATCTCT
AGACTGAGAACTTCAGGGTGAGTTTGGGGACCCTTGATTGTTCTTTCTTTTTCGCTATTGAAAAATTCATGTTATATGGA
GGGGGCAAAGTTTTCAGGGTGTTGTTTAGAATGGGAAGATGTCCCTTGTATCACCATGGACCCTCATGATAATTTTGTTT
CTTTCACTTTCTACTCTGTTGACAACCATTGTCTCCTCTTATTTTCTTTTCATTTTCTGTAACTTTTTTCGTTAAACTTT
AGCTTGCATTTGTAACGAATTTTTAAATTCACTTTCGTTTATTTGTCAGATTGTAAGTACTTTCTCTAATCACTTTTTTT
TCAAGGCAATCAGGGTAATTATATTGTACTTCAGCACAGTTTTAGAGAACAATTGTTATAATTAAATGATAAGGTAGAAT
ATTTCTGCATATAAATTCTGGCTGGCGTGGAAATATTCTTATTGGTAGAAACAACTACATCCTGGTAATCATCCTGCCTT
TCTCTTTATGGTTACAATGATATACACTGTTTGAGATGAGGATAAAATACTCTGAGTCCAAACCGGGCCCCTCTGCTAAC
CATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTGTTGTGCTGTCTCATCATTTTGGCAAAGA
ATTCACTCCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGGCCAATGCCCTGGCTCACAAATACCACTGAG
ATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGGTAATAAAGGAAATTT
ATTTTCATTGCAATAGTGTGTGGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACA
TCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCATATGCTGGCTGCCATGAACAAAGGTGGCTATAAAGAGGT
CATCAGTATATGAAACAGCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGACTTGAGGTTAGATTTTTTTTAT
ATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCAGATTTTTCCTCCTCT
CCTGACTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGAACTCGACTGCATTAATGAATCGGCCAACGCGCGGGGAGA
GGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGT
ATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCC
AGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA
AATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGT
GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAAT
GCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCC
GACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCAC
TGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTA
GAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAA
CAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCC
TTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAA
GGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGAC
AGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGT
CGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGG
CTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATC
CAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTAC
AGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGAT
CCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCA
CTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTC
AACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCAC
ATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGA
TCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAA
AACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAAT
ATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGG
GTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAG
GCGTATCACGAGGCCCTTTCGTCTTCACTCGACGCTGGTCGAGCTGATACTTCCCGTCCGCCAGGGGACATGCCGGCGAT
GCTGAAGGTCGCGCGCATTCCCGATGAAGAGGCCGGTTACCGCCTGTTGACCTGGTGGGACGGGCAGGGCGCCGCCCGAG
TCTTGCCTCGGCGGCGGGCGCTCTGCTCATGGAGCGCGCGTCCGGGGACCTTGCACAGATAGCGTGGTCCGGCCAGACGA
CGAGGCTTGCAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCC
TGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAAT
AGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA
TCATGTCTGGATCCTCTAGAACTAGGTCGACGCGGCCG