Logo ZMBH Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name:  pBI-5           Size:             6083 bp


Resistance:    Ampicillin      constructed by: Udo Baron, Sabine Freundlieb,
                                                            

Host strain:   DH5 alpha, E.coli "sure"


Reference:     unpublished

Plasmid - Map:

Plasmid-Map of pBI-5

Description :

The plasmid consists out of four main fragments:

  1. pBR322-sequences including colE1-origin of replication and ß-lactamase resistance gene with Pbla/p3 of Tn2661 (HincII and PstI-sites removed).
  2. The regulatory region with the bidirectional promotor Pbi-1:
  3. The luciferase gene luc* (Bonin, A.L. et al.,(1994),Gene ,141, 75-77) followed by SV40 late poly(A) signal and transcribed from Pmin-1
  4. Multible cloning site 3, followed by rabbit ß-globin intron/poly(A) signal and transcribed from Pmin-2. Cleavage specificities of MCS 3 are Pvu II, Mlu I, Nhe I, Not I, Cla I, Hind III, Acc I, Sal I, Eco RV.

Restriction sites :

Absent sites :


Afl II    c/ttaag          Nru I     tcg/cga          Sna I     gta/tac          
Age I     a/ccggt          Nsi I     atgca/t          SnaB I    tac/gta          
Avr II    c/ctagg          PaeR7 I   c/tcgag          Sse8337 I cctgca/gg        
Bcl I     t/gatca          Pml I     cac/gtg          Swa I     attt/aaat        
Dra III   cacnnn/gtg       Rsr II    cg/gwccg         Tth111 I  gacn/nngtc       
Eco47 III agc/gct          Sap I     gcttcttc  1/4    Xca I     gta/tac          
Esp I     gc/tnagc         Sfi I     ggccnnnn/nggcc   Xho I     c/tcgag          
Fse I     ggccgg/cc        

Unique sites:


  Enzyme                        Position


  Pst I     ctgca/g                1
  Stu I     agg/cct              457
  Pvu II    cag/ctg              603
  Mlu I     a/cgcgt              609
  Nhe I     g/ctagc              615
  Not I     gc/ggccgc            621
  Eag I     c/ggccg              622
  Cla I     at/cgat              629
  Hind III  a/agctt              635
  Acc I     gt/mkac              641
  Sal I     g/tcgac              641
  EcoR V    gat/atc              647
  Apa I     gggcc/c             1200
  Bsp120 I  g/ggccc             1200
  Bsg I     gtgcag   16/14      1309
  Msc I     tgg/cca             1343
  BstX I    ccannnnn/ntgg       1346
  Bgl II    a/gatct             1374
  PflM I    ccannnn/ntgg        1574
  Drd I     gacnnnn/nngtc       2100
  Bsa I     ggtctc    1/5       2958
  Fsp I     tgc/gca             3111
  Pvu I     cgat/cg             3258
  Xmn I     gaann/nnttc         3486
  Aat II    gacgt/c             3809
  PshA I    gacnn/nngtc         3886
  Nae I     gcc/ggc             3927
  BsaB I    gatnn/nnatc         4108
  Hpa I     gtt/aac             4211
  Spe I     a/ctagt             4356
  EcoN I    cctnn/nnnagg        4452
  SgrA I    cr/ccggyg           4641
  BspM I    acctgc    4/8       4663
  Pac I     ttaat/taa           4748
  Xcm I     ccannnnn/nnnntgg    5333
  Sph I     gcatg/c             5411
  Spl I     c/gtacg             5916
  BsaA I    yac/gtr             5918


Multiple sites:


Enzyme                   Sites       Positions


AlwN I    cagnnn/ctg       2         1243     2409
ApaL I    g/tgcac          2         2312     3558
Ase I     at/taat          2         1827     3062
Asp718    g/gtacc          2          425      582
Bbe I     ggcgc/c          2         4003     6038
BceF I    acggc    12/13   2         2484     4625
BspE I    t/ccgga          2         4859     5375
BssH II   g/cgcgc          2         3946     4049
BstB I    tt/cgaa          2         5114     5902
BstE II   g/gtnacc         2         3970     5462
Bsu36 I   cc/tnagg         2         1303     5457
Ehe I     ggc/gcc          2         4003     6038
Kas I     g/gcgcc          2         4003     6038
Kpn I     ggtac/c          2          425      582
Mme I     tccrac   20/18   2         2188     2372
Nar I     gg/cgcc          2         4003     6038
Nco I     c/catgg          2          789     6072
Sac II    ccgc/gg          2           17      560
Sca I     agt/act          2          951     3369
Sma I     ccc/ggg          2          429      586
Sty I     c/cwwgg          2          789     6072
Xba I     t/ctaga          2          653     4350
Xma I     c/ccggg          2          429      586

BamH I    g/gatcc          3          591     4344     4362
Bsm I     gaatgc    1/-1   3         3950     4195     4294
EcoR I    g/aattc          3            7      570     1294
Nde I     ca/tatg          3         1508     1568     1575
PpuM I    rg/gwccy         3          682     4060     4891
Ssp I     aat/att          3         1053     1087     3693


Site Usage:

 
 Aat II       1    BssH II      2    Hga I       13    Pml I        -    
 Acc I        1    BstB I       2    HgiA I       8    PpuM I       3    
 Afl II       -    BstE II      2    Hha I       25    PshA I       1    
 Afl III      4    BstK I      30    Hinc II      5    Pst I        1    
 Age I        -    BstN I      15    Hind III     1    Pvu I        1    
 Aha II       8    BstU I      21    Hinf I      13    Pvu II       1    
 Alu I       23    BstX I       1    HinP I      25    Rma I       13    
 Alw I       22    BstY I      14    Hpa I        1    Rsa I       12    
 AlwN I       2    Bsu36 I      2    Hpa II      28    Rsr II       -    
 Apa I        1    Cfr10 I      5    Hph I        9    Sac I        4    
 ApaL I       2    Cla I        1    Kas I        2    Sac II       2    
 Ase I        2    Csp6 I      12    Kpn I        2    Sal I        1    
 Asp718       2    Dde I       12    Mae II      10    Sap I        -    
 Ava I        4    Dpn I       29    Mae III     19    Sau3A I     29    
 Ava II       9    Dpn II      29    Mbo I       29    Sau96 I     19    
 Avr II       -    Dra I        6    Mbo II      24    Sca I        2    
 BamH I       3    Dra III      -    Mcr I        6    ScrF I      30    
 Ban I        5    Drd I        1    Mlu I        1    SfaN I       9    
 Ban II       6    Dsa I        4    Mme I        2    Sfe I        5    
 Bbe I        2    Dsa V       30    Mnl I       46    Sfi I        -    
 Bbs I        6    Eae I        5    Msc I        1    SgrA I       1    
 Bbv I       13    Eag I        1    Mse I       23    Sma I        2    
 BceF I       2    Ear I        7    Msp I       28    Sna I        -    
 Bcl I        -    Ecl136 I     4    Nae I        1    SnaB I       -    
 Bcn I       15    Eco47 III    -    Nar I        2    Spe I        1    
 Bgl I        4    Eco57 I      6    Nci I       15    Sph I        1    
 Bgl II       1    EcoN I       1    Nco I        2    Spl I        1    
 Bsa I        1    EcoO109 I    5    Nde I        3    Sse8337 I    -    
 BsaA I       1    EcoR I       3    Nhe I        1    Ssp I        3    
 BsaB I       1    EcoR II     15    Nla III     22    Stu I        1    
 BsaJ I      17    EcoR V       1    Nla IV      27    Sty I        2    
 Bsg I        1    Ehe I        2    Not I        1    Swa I        -    
 BsiE I       6    Esp I        -    Nru I        -    Taq I       25    
 BsiY I      11    Fau I        6    Nsi I        -    Tfi I        5    
 Bsm I        3    Fse I        -    Nsp I        4    Tth111 I     -    
 BsmA I       9    Fnu4H I     26    Nsp7524 I    4    Tth111 II    6    
 Bsp120 I     1    Fok I       12    NspB II      8    Xba I        2    
 Bsp1286 I   10    Fsp I        1    NspC I       4    Xca I        -    
 BspE I       2    Gdi II       4    Pac I        1    Xcm I        1    
 BspH I       5    Gsu I        5    PaeR7 I      -    Xho I        -    
 BspM I       1    Hae I        6    PflM I       1    Xma I        2    
 BspW I      21    Hae II       5    Ple I        8    Xmn I        1    
 Bsr I       12    Hae III     21    



Sequence :


1                                                                              80                                       
CTGCAGGAATTCGGGGCCGCGGAGGCTGGATCGGTCCCGGTGTCTTCTATGGAGGTCAAAACAGCGTGGATGGCGTCTCC
AGGCGATCTGACGGTTCACTAAACGAGCTCTGCTTATATAGGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTG
AAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAA
AGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGA
GAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGA
TAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTT
TAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTC
CGCGGCCCCGAATTCGAGCTCGGTACCCGGGGATCCTCTAGTCAGCTGACGCGTGCTAGCGCGGCCGCATCGATAAGCTT
GTCGACGATATCTCTAGACTGAGAACTTCAGGGTGAGTTTGGGGACCCTTGATTGTTCTTTCTTTTTCGCTATTGAAAAA
TTCATGTTATATGGAGGGGGCAAAGTTTTCAGGGTGTTGTTTAGAATGGGAAGATGTCCCTTGTATCACCATGGACCCTC
ATGATAATTTTGTTTCTTTCACTTTCTACTCTGTTGACAACCATTGTCTCCTCTTATTTTCTTTTCATTTTCTGTAACTT
TTTTCGTTAAACTTTAGCTTGCATTTGTAACGAATTTTTAAATTCACTTTCGTTTATTTGTCAGATTGTAAGTACTTTCT
CTAATCACTTTTTTTTCAAGGCAATCAGGGTAATTATATTGTACTTCAGCACAGTTTTAGAGAACAATTGTTATAATTAA
ATGATAAGGTAGAATATTTCTGCATATAAATTCTGGCTGGCGTGGAAATATTCTTATTGGTAGAAACAACTACATCCTGG
TAATCATCCTGCCTTTCTCTTTATGGTTACAATGATATACACTGTTTGAGATGAGGATAAAATACTCTGAGTCCAAACCG
GGCCCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTGTTGTGCTGTCTCA
TCATTTTGGCAAAGAATTCACTCCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGGCCAATGCCCTGGCTC
ACAAATACCACTGAGATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGACTTCTGGG
TAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTGGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATGGGAGGGC
AAATCATTTAAAACATCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCATATGCTGGCTGCCATGAACAAAGG
TGGCTATAAAGAGGTCATCAGTATATGAAACAGCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGACTTGAGG
TTAGATTTTTTTTATATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTACTAGCCA
GATTTTTCCTCCTCTCCTGACTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGAACTCGACTGCATTAATGAATCGGC
CAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCG
GCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACA
TGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCT
GACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCC
TGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCG
TGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAA
CCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCC
ACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTA
ACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGC
TCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGG
ATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCA
TGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAG
TAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGT
TGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAG
ACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACT
TTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGT
TGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAA
GGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTG
GCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGT
GACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGG
ATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATC
TTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGT
TTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATAC
TCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAA
AATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATT
AACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCACTCGACGCTGGTCGAGCTGATACTTCCCGTCCGCCAGG
GGACATGCCGGCGATGCTGAAGGTCGCGCGCATTCCCGATGAAGAGGCCGGTTACCGCCTGTTGACCTGGTGGGACGGGC
AGGGCGCCGCCCGAGTCTTGCCTCGGCGGCGGGCGCTCTGCTCATGGAGCGCGCGTCCGGGGACCTTGCACAGATAGCGT
GGTCCGGCCAGACGACGAGGCTTGCAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACC
TCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGT
TACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACT
CATCAATGTATCTTATCATGTCTGGATCCTCTAGAACTAGTGGATCCCCCCTAGAGTATTACAATAGCTAAGAATTTCGT
CATCGCTGAATACAGTTACATTTTACAATTTGGACTTTCCGCCCTTCTTGGCCTTTATGAGGATCTCTCTGATTTTTCTT
GCGTCGAGTTTTCCGGTAAGACCTTTCGGTACTTCGTCCACAAACACAACTCCTCCGCGCAACTTTTTGGCGGTTGTTAC
TTGACTGGCGACGTAATCCACGATCTCTTTTTCCGTCATCGTCTTTCCGTGCTCCAAAACAACAACGGCGGCGGGAAGTT
CACCGGCGTCATCGTCGGGAAGACCTGCCACGCCCGCGTCGAAGATGTTGGGGTGTTGTAACAATATCGACTCCAATTCA
GCGGGGGCCACCTGGTATCCTTTGTATTTAATTAAAGACTTCAAGCGGTCAACTATGAAGAAGTGTTCGTCTTCGTCCCA
GTAAGCTATGTCTCCAGAATGTAGCCATCCATCCTTGTCAATCAAGGCGTTGGTCGCTTCCGGATTGTTTACATAACCGG
ACATAATCATAGGTCCTCTGACACATAATTCGCCTCTCTGATTAACGCCCAGCGTTTTCCCGGTATCCAGATCCACAACC
TTCGCTTCAAAAAATGGAACAACTTTACCGACCGCGCCCGGTTTATCATCCCCCTCGGGTGTAATCAGAATAGCTGATGT
AGTCTCAGTGAGCCCATATCCTTGTCGTATCCCTGGAAGATGGAAGCGTTTTGCAACCGCTTCCCCGACTTCTTTCGAAA
GAGGTGCGCCCCCAGAAGCAATTTCGTGTAAATTAGATAAATCGTATTTGTCAATCAGAGTGCTTTTGGCGAAGAATGAA
AATAGGGTTGGTACTAGCAACGCACTTTGAATTTTGTAATCCTGAAGGGATCGTAAAAACAGCTCTTCTTCAAATCTATA
CATTAAGACGACTCGAAATCCACATATCAAATATCCGAGTGTAGTAAACATTCCAAAACCGTGATGGAATGGAACAACAC
TTAAAATCGCAGTATCCGGAATGATTTGATTGCCAAAAATAGGATCTCTGGCATGCGAGAATCTGACGCAGGCAGTTCTA
TGCGGAAGGGCCACACCCTTAGGTAACCCAGTAGATCCAGAGGAGTTCATTATCAGTGCAATTGTTTTGTCACGATCAAA
GGACTCTGGTACAAAATCGTATTCATTAAAACCGGGAGGTAGATGAGATGTGACGAACGTGTACATCGACTGAAATCCCT
GGTAATCCGTTTTAGAATCCATGATAATAATTTTCTGGATTATTGGTAATTTTTTTTGCACGTTCAAAATTTTTTGCAAC
CCCTTTTTGGAAACAAACACTACGGTAGGCTGCGAAATGTTCATACTGTTGAGCAATTCACGTTCATTATAAATGTCGTT
CGCGGGCGCAACTGCAACTCCGATAAATAACGCGCCCAACACCGGCATAAAGAATTGAAGAGAGTTTTCACTGCATACGA
CGATTCTGTGATTTGTATTCAGCCCATATCGTTTCATAGCTTCTGCCAACCGAACGGACATTTCGAAGTATTCCGCGTAC
GTGATGTTCACCTCGATATGTGCATCTGTAAAAGCAATTGTTCCAGGAACCAGGGCGTATCTCTTCATAGCCTTATGCAG
TTGCTCTCCAGCGGTTCCATCCTCTAGCGGATAGAATGGCGCCGGGCCTTTCTTTATGTTTTTGGCGTCTTCCATGGTAC
GGG