Logo Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name: pUHC 13-3       Size:             5157 bp


Resistance:   Ampicillin      constructed by: Manfred Gossen


Host strain:  E.coli "sure"


Reference:    Gossen M. and Bujard H. (1992); PNAS, 89, 5547-51



Plasmid - Map:

Plasmid-Map of pUHC13-3

Description :

The plasmid consists out of three main fragments:

  1. pBR322-sequences including
  2. The regulatory region with
  3. The luciferase gene with 3-flanking region from pSV2 luc described in de Web et al. (1987); Mol.Cell Biol., 7, 725-37

Restriction sites :

Absent sites :


Afl II    c/ttaag          Fse I     ggccgg/cc        PshA I    gacnn/nngtc      
Age I     a/ccggt          Mlu I     a/cgcgt          Pvu II    cag/ctg          
Apa I     gggcc/c          Msc I     tgg/cca          Rsr II    cg/gwccg         
Avr II    c/ctagg          Nae I     gcc/ggc          Sap I     gcttcttc  1/4    
Bgl II    a/gatct          Nco I     c/catgg          Sfi I     ggccnnnn/nggcc   
Bsp120 I  g/ggccc          Nde I     ca/tatg          Sna I     gta/tac          
BssH II   g/cgcgc          Nhe I     g/ctagc          SnaB I    tac/gta          
BstX I    ccannnnn/ntgg    Not I     gc/ggccgc        Spe I     a/ctagt          
Dra III   cacnnn/gtg       Nru I     tcg/cga          Swa I     attt/aaat        
Eag I     c/ggccg          Nsi I     atgca/t          Tth111 I  gacn/nngtc       
Eco47 III agc/gct          Pml I     cac/gtg          Xca I     gta/tac          
Esp I     gc/tnagc         
          

Unique sites:



Enzyme                        Position

PaeR7 I   c/tcgag                7
Xho I     c/tcgag                7
Stu I     agg/cct              342
Dsa I     c/crygg              445
Sac II    ccgc/gg              445
BamH I    g/gatcc              476
Acc I     gt/mkac              488
Sal I     g/tcgac              488
Sse8337 I cctgca/gg            493
Pst I     ctgca/g              494
Hind III  a/agctt              506
Bbe I     ggcgc/c              567
Ehe I     ggc/gcc              567
Kas I     g/gcgcc              567
Nar I     gg/cgcc              567
BsaA I    yac/gtr              687
Spl I     c/gtacg              689
BstE II   g/gtnacc            1142
Bsu36 I   cc/tnagg            1147
Xcm I     ccannnnn/nnnntgg    1263
PpuM I    rg/gwccy            1713
Pac I     ttaat/taa           1855
EcoR V    gat/atc             1871
Cla I     at/cgat             1899
SgrA I    cr/ccggyg           1962
EcoN I    cctnn/nnnagg        2148
PflM I    ccannnn/ntgg        2388
Sty I     c/cwwgg             2542
Bsg I     gtgcag   16/14      2641
Bcl I     t/gatca             2845
BsaB I    gatnn/nnatc         2846
Hpa I     gtt/aac             2949
Drd I     gacnnnn/nngtc       3369
AlwN I    cagnnn/ctg          3678
Bsa I     ggtctc    1/5       4227
Fsp I     tgc/gca             4380
Pvu I     cgat/cg             4527
Sca I     agt/act             4638
Xmn I     gaann/nnttc         4755
Aat II    gacgt/c             5083

Multiple sites:



Enzyme                    Sites    Positions:


Afl III   a/crygt          2    1028     3267
ApaL I    g/tgcac          2    3581     4827
Asp718    g/gtacc          2     310      467
BceF I    acggc    12/13   2    1981     3753
Bgl I     gccnnnn/nggc     2     441     4274
BspE I    t/ccgga          2    1230     1746
BspM I    acctgc    4/8    2     492     1942
BstB I    tt/cgaa          2     703     1491
Eae I     y/ggccr          2    3106     4548
EcoO109 I rg/gnccy         2    1713     5140
Gdi II    yggccg   -5/-1   2    3106     4548
Kpn I     ggtac/c          2     310      467
Sma I     ccc/ggg          2     314      471
Sph I     gcatg/c          2     500     1194
Xma I     c/ccggg          2     314      471

Ase I     at/taat          3    2760     3096     4331
BspH I    t/catga          3    3987     4995     5105
Cfr10 I   r/ccggy          3     804     1963     4240
Ecl136 I  gag/ctc          3     304      357      461
EcoR I    g/aattc          3       1      455     1122
Hae II    rgcgc/y          3     567     3141     3511
Hinc II   gty/rac          3     488     1837     2949
Mme I     tccrac   20/18   3    2387     3457     3641
Nsp I     rcatg/y          3     500     1194     3267
Nsp7524 I r/catgy          3     500     1194     3267
NspC I    rcatg/y          3     500     1194     3267
Sac I     gagct/c          3     304      357      461
Ssp I     aat/att          3    2671     2824     4962



Site Usage:


 Aat II       1    BssH II      -    Hga I        9    Pml I        -    
 Acc I        1    BstB I       2    HgiA I       7    PpuM I       1    
 Afl II       -    BstE II      1    Hha I       18    PshA I       -    
 Afl III      2    BstK I      20    Hinc II      3    Pst I        1    
 Age I        -    BstN I       8    Hind III     1    Pvu I        1    
 Aha II       6    BstU I      14    Hinf I      17    Pvu II       -    
 Alu I       21    BstX I       -    HinP I      18    Rma I       10    
 Alw I       17    BstY I      12    Hpa I        1    Rsa I       11    
 AlwN I       1    Bsu36 I      1    Hpa II      23    Rsr II       -    
 Apa I        -    Cfr10 I      3    Hph I        7    Sac I        3    
 ApaL I       2    Cla I        1    Kas I        1    Sac II       1    
 Ase I        3    Csp6 I      11    Kpn I        2    Sal I        1    
 Asp718       2    Dde I       11    Mae II      10    Sap I        -    
 Ava I        4    Dpn I       25    Mae III     18    Sau3A I     25    
 Ava II       4    Dpn II      25    Mbo I       25    Sau96 I     11    
 Avr II       -    Dra I        5    Mbo II      22    Sca I        1    
 BamH I       1    Dra III      -    Mcr I        5    ScrF I      20    
 Ban I        4    Drd I        1    Mlu I        -    SfaN I       6    
 Ban II       4    Dsa I        1    Mme I        3    Sfe I        5    
 Bbe I        1    Dsa V       20    Mnl I       34    Sfi I        -    
 Bbs I        6    Eae I        2    Msc I        -    SgrA I       1    
 Bbv I       12    Eag I        -    Mse I       25    Sma I        2    
 BceF I       2    Ear I        6    Msp I       23    Sna I        -    
 Bcl I        1    Ecl136 I     3    Nae I        -    SnaB I       -    
 Bcn I       12    Eco47 III    -    Nar I        1    Spe I        -    
 Bgl I        2    Eco57 I      4    Nci I       12    Sph I        2    
 Bgl II       -    EcoN I       1    Nco I        -    Spl I        1    
 Bsa I        1    EcoO109 I    2    Nde I        -    Sse8337 I    1    
 BsaA I       1    EcoR I       3    Nhe I        -    Ssp I        3    
 BsaB I       1    EcoR II      8    Nla III     13    Stu I        1    
 BsaJ I      10    EcoR V       1    Nla IV      17    Sty I        1    
 Bsg I        1    Ehe I        1    Not I        -    Swa I        -    
 BsiE I       5    Esp I        -    Nru I        -    Taq I       21    
 BsiY I      10    Fau I        5    Nsi I        -    Tfi I        8    
 Bsm I        4    Fse I        -    Nsp I        3    Tth111 I     -    
 BsmA I       5    Fnu4H I     20    Nsp7524 I    3    Tth111 II    7    
 Bsp120 I     -    Fok I        8    NspB II      6    Xba I        4    
 Bsp1286 I    8    Fsp I        1    NspC I       3    Xca I        -    
 BspE I       2    Gdi II       2    Pac I        1    Xcm I        1    
 BspH I       3    Gsu I        4    PaeR7 I      1    Xho I        1    
 BspM I       2    Hae I        5    PflM I       1    Xma I        2    
 BspW I      12    Hae II       3    Ple I        9    Xmn I        1    
 Bsr I       11    Hae III     15    



Sequence :


1                                                                              80                                       
GAATTCCTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAG
AAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGAT
AGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAG
TGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGT
CGAGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCA
CGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGAATTCGAGCTCGGTACCCGGGGATC
CTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCATTCCGGTACTGTTGGTAAAATGGAAGACGCCAAAAACATAAAGAA
AGGCCCGGCGCCATTCTATCCTCTAGAGGATGGAACCGCTGGAGAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGG
TTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGAACATCACGTACGCGGAATACTTCGAAATGTCCGTTCGG
TTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTT
TATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCA
ACAGTATGAACATTTCGCAGCCTACCGTAGTGTTTGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAA
TTACCAATAATCCAGAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCAC
ATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTACCAGAGTCCTTTGATCGTGACAAAACAATTGCACTGATAA
TGAATTCCTCTGGATCTACTGGGTTACCTAAGGGTGTGGCCCTTCCGCATAGAACTGCCTGCGTCAGATTCTCGCATGCC
AGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTTTTGGAAT
GTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGCTGTTTTTACGAT
CCCTTCAGGATTACAAAATTCAAAGTGCGTTGCTAGTACCAACCCTATTTTCATTCTTCGCCAAAAGCACTCTGATTGAC
AAATACGATTTATCTAATTTACACGAAATTGCTTCTGGGGGCGCACCTCTTTCGAAAGAAGTCGGGGAAGCGGTTGCAAA
ACGCTTCCATCTTCCAGGGATACGACAAGGATATGGGCTCACTGAGACTACATCAGCTATTCTGATTACACCCGAGGGGG
ATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAAGGTTGTGGATCTGGATACCGGGAAAACGCTG
GGCGTTAATCAGAGAGGCGAATTATGTGTCAGAGGACCTATGATTATGTCCGGTTATGTAAACAATCCGGAAGCGACCAA
CGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACACTTCTTCATAGTTG
ACCGCTTGAAGTCTTTAATTAAATACAAAGGATATCAGGTGGCCCCCGCTGAATTGGAATCGATATTGTTACAACACCCC
AACATCTTCGACGCGGGCGTGGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCA
CGGAAAGACGATGACGGAAAAAGAGATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCCAAAAAGTTGCGCGGAGGAG
TTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAAAACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCC
AAGAAGGGCGGAAAGTCCAAATTGTAAAATGTAACTGTATTCAGCGATGACGAAATTCTTAGCTATTGTAATGACTCTAG
AGGATCTTTGTGAAGGAACCTTACTTCTGTGGTGTGACATAATTGGACAAACTACCTACAGAGATTTAAAGCTCTAAGGT
AAATATAAAATTTTTAAGTGTATAATGTGTTAAACTACTGATTCTAATTGTTTGTGTATTTTAGATTCCAACCTATGGAA
CTGATGAATGGGAGCAGTGGTGGAATGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGAT
GAGGCTACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAAGGACTTTCCTTCAGA
ATTGCTAAGTTTTTTGAGTCATGCTGTGTTTAGTAATAGAACTCTTGCTTGCTTTGCTATTTACACCACAAAGGAAAAAG
CTGCACTGCTATACAAGAAAATTATGGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATA
CTGTTTTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTGTACCTTTAGCTTTTT
AATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTTGATCATAATCAGCCATACCACATTTGTAGAGGTTT
TACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTT
ATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAG
TTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGCCTCTAGAGCTGCATTAATGAATCGGCCAACGCGCGGG
GAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAG
CGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAA
GGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCA
CAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCC
TCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCT
CAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCA
GCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAG
CCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTAC
ACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGG
CAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAG
ATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCA
AAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTC
TGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCC
CCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCA
CCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTC
CATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTG
CTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACA
TGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTT
ATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGT
ACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCG
CCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTT
GAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAG
CAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTT
CAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAAT
AGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTGACGTCTAAGAAACCATTATTATCATGACATTAACCTA
TAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAA