Logo Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name: pUHC 13-6       Size:             ca.6500 bp


Resistance:   Ampicillin      constructed by: Manfred Gossen


Host strain:  E.coli "sure"


Reference:    Manfred Gossen unpublished


Description :

pUHC13-6 is a derivative of pT81 luc (ref.: Nordeen, S.K. 1988 BioTechniques 6: 454-457) which contains the luciferase gene under control of the Tk promoter (position -81 to +52). For details on structure and construction of pT81 luc, please check the above reference. To bring the luciferase gene under tTA control, a heptamerized tet operator sequence and a polylinker were inserted upstream of the Tk promoter (see attached sequence).

The plasmid consists of three main fragments:

  1. pBR322-sequences:
  2. SV40 sequences (ref.: De Wet et al. 1987 Mol.Cell.Biol. 7: 725-737):
  3. the regulatory region * with: (ref.: Nordeen, S.K. 1988 BioTechniques 6: 454-457)
  4. the luciferase gene from pSV232AL-AD5´ (ref.: De Wet et al.(1987), Mol.Cell.Biol. 7: 725-737).




SalI SmaI KpnI SstI                                                XhoI      
GTCGACCCGGGTACCGAGCTC ( GACTTTCACTTTTCTCTATCACTGATAGGGAGTGGTAAACTC ) GAGAT
                                                                           7


CCGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTG
   -81
   
               ->
ACGCGTGTGGCCTCGAACACCGAG   
               +1
                



* the Tk minimal promoter region with the heptamerized tet operators is shown: