Logo Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name: pUHD 10-3       Size:             3146 bp


Resistance:   Ampicillin      constructed by: Manfred Gossen


Host strain:  E.coli "sure"


Reference:    Manfred Gossen unpublished


Plasmid - Map:

Plasmid-Map of pUHD10-3

Description :

The plasmid consists of four main fragments:

  1. pBR322-sequences including
  2. The regulatory region with
  3. Multiple cloning site, MCS, containing SacII, EcoRI and XbaI recognition sequences
  4. SV40 late polyadenylation sequence downstream of the MCS

Restriction sites :

Absent sites :


Acc I     gt/mkac          Eco47 III agc/gct          Pst I     ctgca/g          
Afl II    c/ttaag          EcoN I    cctnn/nnnagg     Rsr II    cg/gwccg         
Age I     a/ccggt          EcoR V    gat/atc          Sal I     g/tcgac          
Apa I     gggcc/c          Esp I     gc/tnagc         Sap I     gcttcttc  1/4    
Avr II    c/ctagg          Fse I     ggccgg/cc        Sfi I     ggccnnnn/nggcc   
Bcl I     t/gatca          Mlu I     a/cgcgt          SgrA I    cr/ccggyg        
Bgl II    a/gatct          Msc I     tgg/cca          Sna I     gta/tac          
BsaA I    yac/gtr          Nco I     c/catgg          SnaB I    tac/gta          
Bsg I     gtgcag   16/14   Nde I     ca/tatg          Spe I     a/ctagt          
Bsp120 I  g/ggccc          Nhe I     g/ctagc          Sph I     gcatg/c          
BspE I    t/ccgga          Not I     gc/ggccgc        Spl I     c/gtacg          
BspM I    acctgc    4/8    Nru I     tcg/cga          Sse8337 I cctgca/gg        
BstB I    tt/cgaa          Nsi I     atgca/t          Sty I     c/cwwgg          
BstX I    ccannnnn/ntgg    Pac I     ttaat/taa        Swa I     attt/aaat        
Bsu36 I   cc/tnagg         PflM I    ccannnn/ntgg     Tth111 I  gacn/nngtc       
Cla I     at/cgat          Pml I     cac/gtg          Xca I     gta/tac          
Dra III   cacnnn/gtg       PshA I    gacnn/nngtc      Xcm I     ccannnnn/nnnntgg 
Eag I     c/ggccg          

          

Unique sites:


Enzyme                        Position

PaeR7 I   c/tcgag                1
Xho I     c/tcgag                1
Stu I     agg/cct              336
Bbs I     gaagac    2/6        414
Dsa I     c/crygg              439
Sac II    ccgc/gg              439
EcoR I    g/aattc              449
Xba I     t/ctaga              476
Hpa I     gtt/aac              615
BsaB I    gatnn/nnatc          714
PpuM I    rg/gwccy             765
Bbe I     ggcgc/c              823
Ehe I     ggc/gcc              823
Kas I     g/gcgcc              823
Nar I     gg/cgcc              823
BstE II   g/gtnacc             855
Nae I     gcc/ggc              899
Hind III  a/agctt              940
Pvu II    cag/ctg             1088
Afl III   a/crygt             1266
Drd I     gacnnnn/nngtc       1368
AlwN I    cagnnn/ctg          1677
BceF I    acggc    12/13      1752
Bsa I     ggtctc    1/5       2226
Fsp I     tgc/gca             2379
Pvu I     cgat/cg             2526
Sca I     agt/act             2637
Xmn I     gaann/nnttc         2754
Ssp I     aat/att             2961
Aat II    gacgt/c             3077

Multiple sites:


Enzyme                    Sites    Positions:

ApaL I    g/tgcac          2    1580     2826
Ase I     at/taat          2    1095     2330
Asp718    g/gtacc          2     304      461
BamH I    g/gatcc          2     470      482
BssH II   g/cgcgc          2     777      880 
EcoO109 I rg/gnccy         2     765     3134
Fau I     cccgc     4/6    2     798     1115
Gsu I     ctggag   16/14   2     379     2244
Hinc II   gty/rac          2     615      845
Kpn I     ggtac/c          2     304      461
Mme I     tccrac   20/18   2    1456     1640
Nsp I     rcatg/y          2     903     1266
Nsp7524 I r/catgy          2     903     1266
NspC I    rcatg/y          2     903     1266
Sma I     ccc/ggg          2     308      465
Tfi I     g/awtc           2    1101     1241
Xma I     c/ccggg          2     308      465

Ban II    grgcy/c          3     298      351      455
Bgl I     gccnnnn/nggc     3     435      801     2273
Bsm I     gaatgc    1/-1   3     532      631      876
BsmA I    gtctc     1/5    3     382     2226     2991
BspH I    t/catga          3    1986     2994     3099
Cfr10 I   r/ccggy          3     859      899     2239
Eae I     y/ggccr          3     741     1105     2547
Ear I     ctcttc    1/4    3     865     1144     2948
Ecl136 I  gag/ctc          3     298      351      455
Eco57 I   ctgaag   16/14   3     889     1793     2841
Gdi II    yggccg   -5/-1   3     741     1105     2547
Sac I     gagct/c          3     298      351      455
Sfe I     c/tryag          3    1531     1722     2400
Tth111 II caarca   11/9    3    1840     1873     1879


Site Usage:


 Aat II       1    BssH II      2    Hga I        5    Pml I        -    
 Acc I        -    BstB I       -    HgiA I       6    PpuM I       1    
 Afl II       -    BstE II      1    Hha I       18    PshA I       -    
 Afl III      1    BstK I      15    Hinc II      2    Pst I        -    
 Age I        -    BstN I       6    Hind III     1    Pvu I        1    
 Aha II       4    BstU I      12    Hinf I       6    Pvu II       1    
 Alu I       16    BstX I       -    HinP I      18    Rma I        5    
 Alw I       14    BstY I       8    Hpa I        1    Rsa I        5    
 AlwN I       1    Bsu36 I      -    Hpa II      16    Rsr II       -    
 Apa I        -    Cfr10 I      3    Hph I        5    Sac I        3    
 ApaL I       2    Cla I        -    Kas I        1    Sac II       1    
 Ase I        2    Csp6 I       5    Kpn I        2    Sal I        -    
 Asp718       2    Dde I        6    Mae II       4    Sap I        -    
 Ava I        4    Dpn I       18    Mae III     10    Sau3A I     18    
 Ava II       5    Dpn II      18    Mbo I       18    Sau96 I      9    
 Avr II       -    Dra I        4    Mbo II       8    Sca I        1    
 BamH I       2    Dra III      -    Mcr I        4    ScrF I      15    
 Ban I        4    Drd I        1    Mlu I        -    SfaN I       7    
 Ban II       3    Dsa I        1    Mme I        2    Sfe I        3    
 Bbe I        1    Dsa V       15    Mnl I       23    Sfi I        -    
 Bbs I        1    Eae I        3    Msc I        -    SgrA I       -    
 Bbv I       10    Eag I        -    Mse I       12    Sma I        2    
 BceF I       1    Ear I        3    Msp I       16    Sna I        -    
 Bcl I        -    Ecl136 I     3    Nae I        1    SnaB I       -    
 Bcn I        9    Eco47 III    -    Nar I        1    Spe I        -    
 Bgl I        3    Eco57 I      3    Nci I        9    Sph I        -    
 Bgl II       -    EcoN I       -    Nco I        -    Spl I        -    
 Bsa I        1    EcoO109 I    2    Nde I        -    Sse8337 I    -    
 BsaA I       -    EcoR I       1    Nhe I        -    Ssp I        1    
 BsaB I       1    EcoR II      6    Nla III     11    Stu I        1    
 BsaJ I       8    EcoR V       -    Nla IV      15    Sty I        -    
 Bsg I        -    Ehe I        1    Not I        -    Swa I        -    
 BsiE I       4    Esp I        -    Nru I        -    Taq I       13    
 BsiY I       5    Fau I        2    Nsi I        -    Tfi I        2    
 Bsm I        3    Fse I        -    Nsp I        2    Tth111 I     -    
 BsmA I       3    Fnu4H I     19    Nsp7524 I    2    Tth111 II    3    
 Bsp120 I     -    Fok I        4    NspB II      5    Xba I        1    
 Bsp1286 I    6    Fsp I        1    NspC I       2    Xca I        -    
 BspE I       -    Gdi II       3    Pac I        -    Xcm I        -    
 BspH I       3    Gsu I        2    PaeR7 I      1    Xho I        1    
 BspM I       -    Hae I        4    PflM I       -    Xma I        2    
 BspW I      13    Hae II       4    Ple I        4    Xmn I        1    
 Bsr I        9    Hae III     13    



Sequence :


1                                                                              80                                       
CTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGT
GAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAA
AAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAG
AGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGTA
GGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGT
TTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGAATTCGAGCTCGGTACCCGGGGATCCTCTAG
AGGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGT
GAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTT
TATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATG
ATCCTGCAAGCCTCGTCGTCTGGCCGGACCACGCTATCTGTGCAAGGTCCCCGGACGCGCGCTCCATGAGCAGAGCGCCC
GCCGCCGAGGCAAGACTCGGGCGGCGCCCTGCCCGTCCCACCAGGTCAACAGGCGGTAACCGGCCTCTTCATCGGGAATG
CGCGCGACCTTCAGCATCGCCGGCATGTCCCCTGGCGGACGGGAAGTATCAGCTCGACCAAGCTTGGCGAGATTTTCAGG
AGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATT
TTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGCATTAATGAATCGGCCAACGCGCGGGG
AGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGC
GGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAG
GCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCAC
AAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCT
CGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTC
AATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAG
CCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGC
CACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACA
CTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGC
AAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGA
TCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAA
AAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCT
GACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCC
CGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCAC
CGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCC
ATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGC
TACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACAT
GATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTA
TCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTA
CTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGC
CACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTG
AGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGC
AAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTC
AATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATA
GGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAA
TAGGCGTATCACGAGGCCCTTTCGTC