Logo ZMBH Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name:  pUHG 16-3       Size:          7169 bp


Resistance:    Ampicillin      Constructor: Manfred Gossen


Host strain:   XL1-blue, DH5 alpha, E.coli "SURE"


Reference:     Manfred Gossen  unpublished


Plasmid - Map:

Plasmid-Map of pUHG16-3

Description :

The plasmid consists out of four main fragments:

  1. pUC-sequences including
  2. The promotor region with
  3. lacZ gene (with N-terminal extension)
  4. rabbit ß-globin intron and polyadenylation signal

Remarks :

The plasmid was constructed by inserting a 3.4 kb XbaI fragment containing a modified lacZ gene (obtained from A. Leutz, MDC Berlin) into the XbaI- linearized vector pUHG10-3 (M.Gossen). The orientation of the insert was verified by sequencing. This plasmid is fully functional with respect to Tc-dependent ß-galactosidase expression in a tTA + background in stable as well as in transient experiments (M. Gossen, unpublished observation)


Restriction sites :

Absent sites :


Afl II    c/ttaag          Fse I     ggccgg/cc        Pst I     ctgca/g          
Age I     a/ccggt          Hind III  a/agctt          Rsr II    cg/gwccg         
Avr II    c/ctagg          Kas I     g/gcgcc          Sal I     g/tcgac          
Bbe I     ggcgc/c          Nae I     gcc/ggc          Sap I     gcttcttc  1/4    
BsaA I    yac/gtr          Nar I     gg/cgcc          Sfi I     ggccnnnn/nggcc   
Bsm I     gaatgc    1/-1   Nhe I     g/ctagc          SgrA I    cr/ccggyg        
BspE I    t/ccgga          Not I     gc/ggccgc        SnaB I    tac/gta          
BstB I    tt/cgaa          Nru I     tcg/cga          Spe I     a/ctagt          
BstE II   g/gtnacc         Nsi I     atgca/t          Sph I     gcatg/c          
Eag I     c/ggccg          Pac I     ttaat/taa        Sse8337 I cctgca/gg        
EcoN I    cctnn/nnnagg     Pml I     cac/gtg          Swa I     attt/aaat        
Ehe I     ggc/gcc          PshA I    gacnn/nngtc      Tth111 I  gacn/nngtc       

Unique sites:


Enzyme                        Position

PaeR7 I   c/tcgag                1
Xho I     c/tcgag                1
Stu I     agg/cct              336
Sac II    ccgc/gg              439
Cla I     at/cgat             1435
EcoR V    gat/atc             1723
Dra III   cacnnn/gtg          1797
BsaB I    gatnn/nnatc         1939
Bcl I     t/gatca             1958
BssH II   g/cgcgc             2110
Eco47 III agc/gct             2445
Acc I     gt/mkac             3375
Sna I     gta/tac             3375
Xca I     gta/tac             3375
Spl I     c/gtacg             3383
Esp I     gc/tnagc            3624
PpuM I    rg/gwccy            3969
Nco I     c/catgg             4076
Sty I     c/cwwgg             4076
Apa I     gggcc/c             4487
Bsp120 I  g/ggccc             4487
Msc I     tgg/cca             4630
Bgl II    a/gatct             4661
Bsa I     ggtctc    1/5       6245

Multiple sites:


Enzyme                    Sites    Positions:



Aat II    gacgt/c          2    1231     7096
Ase I     at/taat          2    5114     6349
Asp718    g/gtacc          2     304      461
BamH I    g/gatcc          2     470      482
BspM I    acctgc    4/8    2    1395     3267
Bsu36 I   cc/tnagg         2     835     4590
Drd I     gacnnnn/nngtc    2    2715     5387
EcoR I    g/aattc          2     449     4581
Fsp I     tgc/gca          2     752     6398
Hpa I     gtt/aac          2    1036     1660
Kpn I     ggtac/c          2     304      461
Sca I     agt/act          2    4238     6656
Xba I     t/ctaga          2     476     3940
Xcm I     ccannnnn/nnnntgg 2    2822     3567
Xmn I     gaann/nnttc      2    3695     6773

BstX I    ccannnnn/ntgg    3    2825     3442     4633
EcoO109 I rg/gnccy         3    3969     4487     7153
Mlu I     a/cgcgt          3    1914     2694     3119
Nsp I     rcatg/y          3    3371     5031     5285
Nsp7524 I r/catgy          3    3371     5031     5285
NspC I    rcatg/y          3    3371     5031     5285
PflM I    ccannnn/ntgg     3    1851     2217     4861
Sma I     ccc/ggg          3     308      465      487
Xma I     c/ccggg          3     308      465      487


Site Usage:


 Aat II       2    BssH II      1    Hga I       13    Pml I        -    
 Acc I        1    BstB I       -    HgiA I       9    PpuM I       1    
 Afl II       -    BstE II      -    Hha I       41    PshA I       -    
 Afl III      6    BstK I      31    Hinc II      4    Pst I        -    
 Age I        -    BstN I      15    Hind III     -    Pvu I        4    
 Aha II       6    BstU I      37    Hinf I      13    Pvu II       4    
 Alu I       22    BstX I       3    HinP I      41    Rma I        6    
 Alw I       21    BstY I      10    Hpa I        2    Rsa I       11    
 AlwN I       5    Bsu36 I      2    Hpa II      31    Rsr II       -    
 Apa I        1    Cfr10 I      5    Hph I       15    Sac I        4    
 ApaL I       4    Cla I        1    Kas I        -    Sac II       1    
 Ase I        2    Csp6 I      11    Kpn I        2    Sal I        -    
 Asp718       2    Dde I       13    Mae II      13    Sap I        -    
 Ava I        6    Dpn I       33    Mae III     28    Sau3A I     33    
 Ava II       6    Dpn II      33    Mbo I       33    Sau96 I     16    
 Avr II       -    Dra I        6    Mbo II      17    Sca I        2    
 BamH I       2    Dra III      1    Mcr I       13    ScrF I      31    
 Ban I        7    Drd I        2    Mlu I        3    SfaN I      14    
 Ban II       6    Dsa I        7    Mme I        5    Sfe I        6    
 Bbe I        -    Dsa V       31    Mnl I       40    Sfi I        -    
 Bbs I        4    Eae I        5    Msc I        1    SgrA I       -    
 Bbv I       26    Eag I        -    Mse I       24    Sma I        3    
 BceF I      16    Ear I        4    Msp I       31    Sna I        1    
 Bcl I        1    Ecl136 I     4    Nae I        -    SnaB I       -    
 Bcn I       16    Eco47 III    1    Nar I        -    Spe I        -    
 Bgl I        4    Eco57 I      5    Nci I       16    Sph I        -    
 Bgl II       1    EcoN I       -    Nco I        1    Spl I        1    
 Bsa I        1    EcoO109 I    3    Nde I        5    Sse8337 I    -    
 BsaA I       -    EcoR I       2    Nhe I        -    Ssp I        4    
 BsaB I       1    EcoR II     15    Nla III     26    Stu I        1    
 BsaJ I      17    EcoR V       1    Nla IV      25    Sty I        1    
 Bsg I        7    Ehe I        -    Not I        -    Swa I        -    
 BsiE I      13    Esp I        1    Nru I        -    Taq I       23    
 BsiY I      16    Fau I       10    Nsi I        -    Tfi I        7    
 Bsm I        -    Fse I        -    Nsp I        3    Tth111 I     -    
 BsmA I       8    Fnu4H I     49    Nsp7524 I    3    Tth111 II    4    
 Bsp120 I     1    Fok I       22    NspB II     16    Xba I        2    
 Bsp1286 I   12    Fsp I        2    NspC I       3    Xca I        1    
 BspE I       -    Gdi II       4    Pac I        -    Xcm I        2    
 BspH I       5    Gsu I        6    PaeR7 I      1    Xho I        1    
 BspM I       2    Hae I        9    PflM I       3    Xma I        3    
 BspW I      31    Hae II      10    Ple I        6    Xmn I        2    
 Bsr I       22    Hae III     27    



Sequence :


1                                                                              80                                       
CTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGT
GAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAA
AAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAG
AGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGTA
GGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGT
TTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGAATTCGAGCTCGGTACCCGGGGATCCTCTAG
AGGATCCCCGGGATCGAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACCATGTCGTTTACTTTGACCAACAAGAACGTGAT
TTTCGTTGCCGGTCTGGGAGGCATTGGTCTGGACACCAGCAAGGAGCTGCTCAAGCGCGATCCCGTCGTTTTACAACGTC
GTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCTTTATAGCGAA
GAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTTTGCCTGGTTTCCGGCACCAGA
AGCGGTGCCGGAAAGCTGGCTGGAGTGCGATCTTCCTGAGGCCGATACTGTCGTCGTCCCCTCAAACTGGCAGATGCACG
GTTACGATGCGCCCATCTACACCAACGTAACCTATTCCATTACGGTCAATCCGCCGTTTGTTCCCACGGAGAATCCGACG
GGTTGTTACTCGCTCACATTTAATGTTGATGAAAGCTGGCTACAGGAAGGCCAGACGCGAATTATTTTTGATGGCGTTAA
CTTGGCGTTTCATCTGTGGTGCAACGTGCGCTGGGTCGGTTACGGCCAGGACAGTCGTTTGCCGTCTGAATTTGACCTGA
GCGCATTTTTACGCGCCGGAGAAAACCGCCTCGCGGTGATGGTGCTGCGTTGGAGTGACGGCAGTTATCTGGAAGATCAG
GATATGTGGCGGATGAGCGGCATTTTCCGTGACGTCTCGTTGCTGCATAAACCGACTACACAAATCAGCGATTTCCATGT
TGCCACTCGCTTTAATGATGATTTCAGCCGCGCTGAACTGGAGGCTGAAGTTCAGATGTGCGGCGAGTTGCGTGACTACC
TACGGGTAACAGTTTCTTTATGGCAGGGTGAAACGCAGGTCGCCAGCGGCACCGCGCCTTTCGGCGGTGAAATTATCGAT
GAGCGTGGTGGTTATGCCGATCGCGTCACACTACGTCTGAACGTCGAAAACCCGAAACTGTGGAGCGCCGAAATCCCGAA
TCTCTATCGTGCGGTGGTTGAACTGCACACCGCCGACGGCACGCTGATTGAAGCAGAAGCCTGCGATGTCGGTTTCCGCG
AGGTGCGGATTGAAAATGGTCTGCTGCTGCTGAACGGCAAGCCGTTGCTGATTCGAGGCGTTAACCGTCACGAGCATCAT
CCTCTGCATGGTCAGGTCATGGATGAGCAGACGATGGTGCAGGATATCCTGCTGATGAAGCAGAACAACTTTAACGCCGT
GCGCTGTTCGCATTATCCGAACCATCCGCTGTGGTACACGCTGTGCGACCGCTACGGCCTGTATGTGGTGGATGAAGCCA
ATATTGAAACCCACGGCATGGTGCCAATGAATCTGCTGACCGATGATCCGCGCTGGCTACCGGCGATGAGCGAACGCGTA
ACGCGAATGGTGCAGCGCGATCGTAATCACCCGAGTGTGATCATCTGGTCGCTGGGGAATGAATCAGGCCACGGCGCTAA
TCACGACGCGCTGTATCGCTGGATCAAATCTGTCGATCCTTCCCGCCCGGTGCAGTATGAAGGCGGCGGAGCCGACACCA
CGGCCACCGATATTATTTGCCCGATGTACGCGCGCGTGGATGAAGACCAGCCCTTCCCGGCTGTGCCGAAATGGTCCATC
AAAAAATGGCTTTCGCTACCTGGAGAGACGCGCCCGCTGATCCTTTGCGAATACGCCCACGCGATGGGTAACAGTCTTGG
CGGTTTCGCTAAATACTGGCAGGCGTTTCGTCAGTATCCCCGTTTACAGGGCGGCTTCGTCTGGGACTGGGTGGATCAGT
CGCTGATTAAATATGATGAAAACGGCAACCCGTGGTCGGCTTACGGCGGTGATTTTGGCGATACGCCGAACCATCGCCAG
TTCTGTATGAACGGTCTGGTCTTTGCCGACCGCACGCCGCATCCAGCGCTGACGGAAGCAAAACACCAGCAGCAGTTTTT
CCAGTTCCGTTTATCCGGGCAAACCATCGAAGTGACCAGCGAATACCTGTTCCGTCATAGCGATAACGAGCTCCTGCACT
GGATGGTGGCGCTGGATGGTAAGCCGCTGGCAAGCGGTGAAGTGCCTCTGGATGTCGCTCCACAAGGTAAACAGTTGATT
GAACTGCCTGAACTACCGCAGCCGGAGAGCGCCGGGCAACTCTGGCTCACAGTACGCGTAGTGCAACCGAACGCGACCGG
ATGGTCAGAAGCCGGGCACATCAGCGCCTGGCAGCAGTGGCGTCTGGCGGAAAACCTCAGTGTGACGCTCCCCGCCGCGT
CCCACGCCATCCCGCATCTGACCACCAGCGAAATGGATTTTTGCATCGAGCTGGGTAATAAGCGTTGGCAATTTAACCGC
CAGTCAGGCTTTCTTTCACAGCTGTGGATTGGCGATAAAAAACAACTGCTGACGCCGCTGCGCGATCAGTTCACCCGTGC
ACCGCTGGATAACGACATTGGCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGAACGCTGGAAGGCGGCGG
GCCATTACCAGGCCGAAGCAGCGTTGTTGCAGTGCACGGCAGATACACTTGCTGATGCGGTGCTGATTACGACCGCTCAC
GCGTGGCAGCATCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGTGGTCAAATGGCGATTAC
CGTTGATGTTGAAGTGGCGAGCGATACACCGCATCCGGCGCGGATTGGCCTGAACTGCCAGCTGGCGCAGGTAGCAGAGC
GGGTAAACTGGCTCGGATTAGGGCCGCAAGAAAACTATCCCGACCGCCTTACTGCCGCCTGTTTTGACCGCTGGGATCTG
CCATTGTCAGACATGTATACCCCGTACGTCTTCCCGAGCGAAAACGGTCTGCGCTGCGGGACGCGCGAATTGAATTATGG
CCCACACCAGTGGCGCGGCGACTTCCAGTTCAACATCAGCCGCTACAGTCAACAGCAACTGATGGAAACCAGCCATCGCC
ATCTGCTGCACGCGGAAGAAGGCACATGGCTGAATATCGACGGTTTCCATATGGGGATTGGTGGCGACGACTCCTGGAGC
CCGTCAGTATCGGCGGAATTACAGCTGAGCGCCGGTCGCTACCATTACCAGTTGGTCTGGTGTCAAAAATAATAATAACC
GGCAGGCCATGTCTGAAAGTATTCGCGTAAGGAAATCCATTATGTACTATTTAAAAAACACAAACTTTTGGATGTTCGGT
TTATTCTTTTTCTTTTACTTTTTTATCATGGGAGCCTACTTCCCGTTTTTCCCGATTTGGCTACATGACATCAACCATAT
GAGCAAAAGTGATACGGGTATTATTTTTGCCGCTATTTCTCTGTTGTCGCTATTATTCCAACCGCTGTTGGTCTGCTTTC
TGACAAACTCGGCCTCGACTCTAGACTGAGAACTTCAGGGTGAGTTTGGGGACCCTTGATTGTTCTTTCTTTTTCGCTAT
TGAAAAATTCATGTTATATGGAGGGGGCAAAGTTTTCAGGGTGTTGTTTAGAATGGGAAGATGTCCCTTGTATCACCATG
GACCCTCATGATAATTTTGTTTCTTTCACTTTCTACTCTGTTGACAACCATTGTCTCCTCTTATTTTCTTTTCATTTTCT
GTAACTTTTTTCGTTAAACTTTAGCTTGCATTTGTAACGAATTTTTAAATTCACTTTCGTTTATTTGTCAGATTGTAAGT
ACTTTCTCTAATCACTTTTTTTTCAAGGCAATCAGGGTAATTATATTGTACTTCAGCACAGTTTTAGAGAACAATTGTTA
TAATTAAATGATAAGGTAGAATATTTCTGCATATAAATTCTGGCTGGCGTGGAAATATTCTTATTGGTAGAAACAACTAC
ATCCTGGTAATCATCCTGCCTTTCTCTTTATGGTTACAATGATATACACTGTTTGAGATGAGGATAAAATACTCTGAGTC
CAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAACGTGCTGGTTGTTGTGC
TGTCTCATCATTTTGGCAAAGAATTCACTCCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGCTGGTGTGGCCAATGCC
CTGGCTCACAAATACCACTGAGATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGCCCCTTGAGCATCTGAC
TTCTGGGTAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTGGGAATTTTTTGTGTCTCTCACTCGGAAGGACATATG
GGAGGGCAAATCATTTAAAACATCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCATATGCTGGCTGCCATGA
ACAAAGGTGGCTATAAAGAGGTCATCAGTATATGAAACAGCCCCCTGCTGTCCATTCCTTATTCCATAGAAAAGCCTTGA
CTTGAGGTTAGATTTTTTTTATATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATTTTCCTTACATGTTTTA
CTAGCCAGATTTTTCCTCCTCTCCTGACTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGAACTCGACTGCATTAATG
AATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGG
TCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGA
AAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCG
CCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGT
TTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCG
GGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGT
GCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACT
TATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGG
TGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGT
TGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAA
AAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATT
TTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTAT
ATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCAT
CCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATA
CCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCC
TGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGC
GCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAA
CGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAG
TAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCT
TTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCA
ATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTC
AAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCA
CCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATA
CTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTAT
TTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCA
TGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCA