Logo ZMBH Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name:  pUHD 172-1 neo       Size:             7274 bp


Resistance:    Ampicillin           constructed by: Manfred Gossen


Host strain:   XL1 blue, DH5 alpha, E.coli "SURE"


Reference:     Gossen M. et al. (1995); Science, 268, 1766-1769


Plasmid - Map:

Plasmid-Map of pUHD172-1

Description :

The plasmid consists of four main fragments:

  1. pBR322-sequences including
  2. The regulatory region with
  3. The rtTA-gene
  4. neo-marker derived as a 2.8 kb XhoI fragment from pSV2neo

Remark:

We only have the exact sequence of pUHD172-1 without the neo cassette. So the listed restriction site positions and the sequence belong to pUHD172-1.


Restriction sites :

Absent sites :


Afl II    c/ttaag          Eag I     c/ggccg          Pst I     ctgca/g          
Age I     a/ccggt          EcoR V    gat/atc          Rsr II    cg/gwccg         
Apa I     gggcc/c          Esp I     gc/tnagc         Sap I     gcttcttc  1/4    
Asp718    g/gtacc          Fse I     ggccgg/cc        Sfi I     ggccnnnn/nggcc   
Avr II    c/ctagg          Kpn I     ggtac/c          SgrA I    cr/ccggyg        
Bgl II    a/gatct          Msc I     tgg/cca          Sna I     gta/tac          
Bsp120 I  g/ggccc          Nhe I     g/ctagc          Sse8337 I cctgca/gg        
BspE I    t/ccgga          Not I     gc/ggccgc        Stu I     agg/cct          
BspM I    acctgc    4/8    Nru I     tcg/cga          Swa I     attt/aaat        
BstB I    tt/cgaa          Nsi I     atgca/t          Tth111 I  gacn/nngtc       
Bsu36 I   cc/tnagg         Pac I     ttaat/taa        Xca I     gta/tac          
Cla I     at/cgat          PflM I    ccannnn/ntgg     Xcm I     ccannnnn/nnnntgg 
Dra III   cacnnn/gtg       Pml I     cac/gtg          

          

Unique sites:


Enzyme                        Position

  PaeR7 I   c/tcgag                1
  Xho I     c/tcgag                1    
  Spe I     a/ctagt              103    
  BsaA I    yac/gtr              442    
  SnaB I    tac/gta              442    
  Nco I     c/catgg              464    
  Bbs I     gaagac    2/6        731    
  EcoR I    g/aattc              766    
  Xba I     t/ctaga              796    
  BstX I    ccannnnn/ntgg        885    
  EcoN I    cctnn/nnnagg         997    
  Mlu I     a/cgcgt             1178    
  Eco47 III agc/gct             1195    
  Bsg I     gtgcag   16/14      1334    
  Spl I     c/gtacg             1429    
  Sal I     g/tcgac             1557    
  PshA I    gacnn/nngtc         1572    
  Sph I     gcatg/c             1629    
  Sma I     ccc/ggg             1683    
  Xma I     c/ccggg             1683    
  BamH I    g/gatcc             1810    
  Hpa I     gtt/aac             1943    
  PpuM I    rg/gwccy            2093    
  Bbe I     ggcgc/c             2151    
  Ehe I     ggc/gcc             2151    
  Kas I     g/gcgcc             2151    
  Nar I     gg/cgcc             2151    
  BstE II   g/gtnacc            2183    
  Nae I     gcc/ggc             2227    
  Pvu II    cag/ctg             2416    
  Drd I     gacnnnn/nngtc       2696    
  AlwN I    cagnnn/ctg          3005    
  Fsp I     tgc/gca             3707     
  Pvu I     cgat/cg             3854     
  Sca I     agt/act             3965     
  Xmn I     gaann/nnttc         4082     
  Ssp I     aat/att             4289     


Multiple sites:


Enzyme                    Sites    Positions:

Acc I     gt/mkac          2       1449     1557         
ApaL I    g/tgcac          2       2908     4154         
Ban II    grgcy/c          2        668     1594         
Bcl I     t/gatca          2       1323     1367 
Bsa I     ggtctc    1/5    2        783     3554
BsaB I    gatnn/nnatc      2       1648     2042
Ecl136 I  gag/ctc          2        668     1594
Gsu I     ctggag   16/14   2        696     3572
Hind III  a/agctt          2        889     2268
Nde I     ca/tatg          2        337     1371
Sac I     gagct/c          2        668     1594
Sac II    ccgc/gg          2        756     1535

Afl III   a/crygt          3       1178     1661     2594
Ase I     at/taat          3        110     2423     3658
Ava I     c/ycgrg          3          1     1683     2144
Bsm I     gaatgc    1/-1   3       1860     1959     2204
BspH I    t/catga          3       3314     4322     4427
BssH II   g/cgcgc          3       1424     2105     2208
Cfr10 I   r/ccggy          3       2187     2227     3567
Dsa I     c/crygg          3        464      756     1535
Eco57 I   ctgaag   16/14   3       2217     3121     4169
EcoO109 I rg/gnccy         3       1460     2093     4462
Hae I     wgg/ccw          3       2607     2618     3070
Sty I     c/cwwgg          3        464     1329     1773
Tth111 II caarca   11/9    3       3168     3201     3207
 

Site usage :


 Aat II       5    Bsm I        3    Eco57 I      3    Mcr I        5    Rsr II       -    
 Acc I        2    BsmA I       5    EcoN I       1    Mlu I        1    Sac I        2    
 Afl II       -    Bsp120 I     -    EcoO109 I    3    Mme I        4    Sac II       2    
 Afl III      3    Bsp1286 I    5    EcoR I       1    Mnl I       28    Sal I        1    
 Age I        -    BspE I       -    EcoR II      9    Msc I        -    Sap I        -    
 Aha II      10    BspH I       3    EcoR V       -    Mse I       18    Sau3A I     22    
 Alu I       20    BspM I       -    Ehe I        1    Msp I       17    Sau96 I     16    
 Alw I       12    BspW I      24    Esp I        -    Nae I        1    Sca I        1    
 AlwN I       1    Bsr I       10    Fau I        9    Nar I        1    ScrF I      18    
 Apa I        -    BssH II      3    Fse I        -    Nci I        9    SfaN I      10    
 ApaL I       2    BstB I       -    Fnu4H I     24    Nco I        1    Sfe I        4    
 Ase I        3    BstE II      1    Fok I        4    Nde I        2    Sfi I        -    
 Asp718       -    BstK I      18    Fsp I        1    Nhe I        -    SgrA I       -    
 Ava I        3    BstN I       9    Gdi II       4    Nla III     19    Sma I        1    
 Ava II       7    BstU I      23    Gsu I        2    Nla IV      18    Sna I        -    
 Avr II       -    BstX I       1    Hae I        3    Not I        -    SnaB I       1    
 BamH I       1    BstY I       7    Hae II       6    Nru I        -    Spe I        1    
 Ban I        4    Bsu36 I      -    Hae III     20    Nsi I        -    Sph I        1    
 Ban II       2    Cfr10 I      3    Hga I        9    Nsp I        5    Spl I        1    
 Bbe I        1    Cla I        -    HgiA I       5    Nsp7524 I    5    Sse8337 I    -    
 Bbs I        1    Csp6 I      13    Hha I       28    NspB II      6    Ssp I        1    
 Bbv I       12    Dde I       10    Hinc II      4    NspC I       5    Stu I        -    
 BceF I       5    Dpn I       22    Hind III     2    Pac I        -    Sty I        3    
 Bcl I        2    Dpn II      22    Hinf I      10    PaeR7 I      1    Swa I        -    
 Bcn I        9    Dra I        5    HinP I      28    PflM I       -    Taq I       13    
 Bgl I        6    Dra III      -    Hpa I        1    Ple I        6    Tfi I        4    
 Bgl II       -    Drd I        1    Hpa II      17    Pml I        -    Tth111 I     -    
 Bsa I        2    Dsa I        3    Hph I        8    PpuM I       1    Tth111 II    3    
 BsaA I       1    Dsa V       18    Kas I        1    PshA I       1    Xba I        1    
 BsaB I       2    Eae I        4    Kpn I        -    Pst I        -    Xca I        -    
 BsaJ I      12    Eag I        -    Mae II      12    Pvu I        1    Xcm I        -    
 Bsg I        1    Ear I        4    Mae III     13    Pvu II       1    Xho I        1    
 BsiE I       5    Ecl136 I     2    Mbo I       22    Rma I        8    Xma I        1    
 BsiY I      10    Eco47 III    1    Mbo II      11    Rsa I       13    Xmn I        1    

          

Sequence :


1                                                                              80                                       
CTCGAGGAGCTTGGCCCATTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACC
GCCATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGT
TCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACG
TATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGCTAAACTGCCCACTTGGC
AGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCC
AGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTT
TGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAG
TTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGC
GTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTT
GACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGAATTCACCATGCCAAAGAGACCCAGACCCTCTAG
ATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAAC
TCGCCCAGAAGCTTGGTGTAGAGCAGCCTACACTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCC
ATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAAAAGGGGAAAGCTGGCAAGATTTTTTACGCAATAACGC
TAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCAATGGAGCAAAAGTACATTCAGATACACGGCCTACAGAAAAACAGT
ATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAACGCGTTATATGCACTCAGCGCT
GTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTAC
TGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCC
TTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGCGTACAGCCGCGCGCGTACGAAAAAC
AATTACGGGTCTACCATCGAGGGCCTGCTCGATCTCCCGGACGACGACGCCCCCGAAGAGGCGGGGCTGGCGGCTCCGCG
CCTGTCCTTTCTCCCCGCGGGACACACGCGCAGACTGTCGACGGCCCCCCCGACCGATGTCAGCCTGGGGGACGAGCTCC
ACTTAGACGGCGAGGACGTGGCGATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGACATGTTGGGGGACGGGGAT
TCCCCGGGTCCGGGATTTACCCCCCACGACTCCGCCCCCTACGGCGCTCTGGATATGGCCGACTTCGAGTTTGAGCAGAT
GTTTACCGATGCCCTTGGAATTGACGAGTACGGTGGGTAGGGGGCGCGAGGATCCAGACATGATAAGATACATTGATGAG
TTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAAC
CATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGG
TTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTGCAAGCCTCGTCGTCTGGCCGGACCAC
GCTATCTGTGCAAGGTCCCCGGACGCGCGCTCCATGAGCAGAGCGCCCGCCGCCGAGGCAAGACTCGGGCGGCGCCCTGC
CCGTCCCACCAGGTCAACAGGCGGTAACCGGCCTCTTCATCGGGAATGCGCGCGACCTTCAGCATCGCCGGCATGTCCCC
TGGCGGACGGGAAGTATCAGCTCGACCAAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCA
CTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACC
TATAACCAGACCGTTCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGC
TTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGT
TATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCC
GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAA
CCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTA
CCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTG
TAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCG
TCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATG
TAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTG
CTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTT
TGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTC
AGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAA
AAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACC
TATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCT
TACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA
GCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAG
AGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTG
GTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGC
TCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTC
TCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGC
GGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATT
GGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACC
CAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGG
GAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGT
CTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCC
ACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC