Logo Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name: pUHG17-1       Size:             5021 bp


Resistance:   Ampicillin      constructed by: Manfred Gossen


Host strain:  XL-1 Blue, DH5 alpha, E.coli "SURE"


Reference:    Gossen, M. et al (1995),Science, 268, 1766-1769


Plasmid - Map:

Plasmid-Map of pUHG17-1

Description :

The plasmid consists of three main fragments:

  1. pBR322-sequences including
  2. The regulatory region with
  3. The rtTA-gene

Restriction sites :

Absent sites :


Afl II    c/ttaag          Ehe I     ggc/gcc          Pst I     ctgca/g          
Age I     a/ccggt          Esp I     gc/tnagc         Pvu II    cag/ctg          
Asp718    g/gtacc          Fse I     ggccgg/cc        Rsr II    cg/gwccg         
Avr II    c/ctagg          Hpa I     gtt/aac          Sap I     gcttcttc  1/4    
Bbe I     ggcgc/c          Kas I     g/gcgcc          Sfi I     ggccnnnn/nggcc   
Bsm I     gaatgc    1/-1   Kpn I     ggtac/c          SgrA I    cr/ccggyg        
BspE I    t/ccgga          Nae I     gcc/ggc          Sna I     gta/tac          
BspM I    acctgc    4/8    Nar I     gg/cgcc          Sse8337 I cctgca/gg        
BstB I    tt/cgaa          Nhe I     g/ctagc          Stu I     agg/cct          
BstE II   g/gtnacc         Not I     gc/ggccgc        Swa I     attt/aaat        
Cla I     at/cgat          Nru I     tcg/cga          Tth111 I  gacn/nngtc       
Dra III   cacnnn/gtg       Nsi I     atgca/t          Xca I     gta/tac          
Eag I     c/ggccg          Pac I     ttaat/taa        Xcm I     ccannnnn/nnnntgg 
EcoR V    gat/atc          Pml I     cac/gtg          

          

Unique sites:


  Enzyme                        Position

  PaeR7 I   c/tcgag                1
  Xho I     c/tcgag                1
  Spe I     a/ctagt              103
  BsaA I    yac/gtr              442
  SnaB I    tac/gta              442
  Bbs I     gaagac    2/6        731
  Hind III  a/agctt              869
  EcoN I    cctnn/nnnagg         977
  Mlu I     a/cgcgt             1158
  Eco47 III agc/gct             1175
  BssH II   g/cgcgc             1404
  Spl I     c/gtacg             1409
  Sal I     g/tcgac             1537
  PshA I    gacnn/nngtc         1552
  Sph I     gcatg/c             1609
  BsaB I    gatnn/nnatc         1628
  Sma I     ccc/ggg             1663
  Xma I     c/ccggg             1663
  BamH I    g/gatcc             1790
  PpuM I    rg/gwccy            1825
  Apa I     gggcc/c             2343
  Bsp120 I  g/ggccc             2343
  Bsu36 I   cc/tnagg            2446
  Msc I     tgg/cca             2486
  Bgl II    a/gatct             2517
  PflM I    ccannnn/ntgg        2717
  Drd I     gacnnnn/nngtc       3243
  Bsa I     ggtctc    1/5       4101
  Cfr10 I   r/ccggy             4114
  Fsp I     tgc/gca             4254
  Pvu I     cgat/cg             4401
  Xmn I     gaann/nnttc         4629

Multiple sites:


Enzyme                    Sites    Positions:

Acc I     gt/mkac          2       1429     1537
AlwN I    cagnnn/ctg       2       2386     3552
ApaL I    g/tgcac          2       3455     4701
Ava I     c/ycgrg          2          1     1663
Bcl I     t/gatca          2       1303     1347
Bsg I     gtgcag   16/14   2       1314     2452
BstX I    ccannnnn/ntgg    2        865     2489
Ecl136 I  gag/ctc          2        668     1574
EcoR I    g/aattc          2        765     2437
Gsu I     ctggag   16/14   2        696     4119
Nco I     c/catgg          2        464     1932
Sac I     gagct/c          2        668     1574
Sac II    ccgc/gg          2        756     1515
Sca I     agt/act          2       2094     4512
Xba I     t/ctaga          2        776     1796

Ase I     at/taat          3        110     2970     4205
Ban I     g/gyrcc          3        569      957     3982
Ban II    grgcy/c          3        668     1574     2343
Gdi II    yggccg   -5/-1   3       1716     2980     4422
Hinc II   gty/rac          3         86     1537     1976
Ssp I     aat/att          3       2196     2230     4836
 

Site Usage:


 Aat II       5    BssH II      1    Hga I        8    Pml I        -    
 Acc I        2    BstB I       -    HgiA I       5    PpuM I       1    
 Afl II       -    BstE II      -    Hha I       22    PshA I       1    
 Afl III      4    BstK I      19    Hinc II      3    Pst I        -    
 Age I        -    BstN I      10    Hind III     1    Pvu I        1    
 Aha II       9    BstU I      19    Hinf I      10    Pvu II       -    
 Alu I       17    BstX I       2    HinP I      22    Rma I        9    
 Alw I       11    BstY I       8    Hpa I        -    Rsa I       14    
 AlwN I       2    Bsu36 I      1    Hpa II      14    Rsr II       -    
 Apa I        1    Cfr10 I      1    Hph I        9    Sac I        2    
 ApaL I       2    Cla I        -    Kas I        -    Sac II       2    
 Ase I        3    Csp6 I      14    Kpn I        -    Sal I        1    
 Asp718       -    Dde I       13    Mae II      13    Sap I        -    
 Ava I        2    Dpn I       22    Mae III     14    Sau3A I     22    
 Ava II       7    Dpn II      22    Mbo I       22    Sau96 I     18    
 Avr II       -    Dra I        6    Mbo II      13    Sca I        2    
 BamH I       1    Dra III      -    Mcr I        5    ScrF I      19    
 Ban I        3    Drd I        1    Mlu I        1    SfaN I       8    
 Ban II       3    Dsa I        4    Mme I        4    Sfe I        5    
 Bbe I        -    Dsa V       19    Mnl I       34    Sfi I        -    
 Bbs I        1    Eae I        4    Msc I        1    SgrA I       -    
 Bbv I       12    Eag I        -    Mse I       21    Sma I        1    
 BceF I       5    Ear I        4    Msp I       14    Sna I        -    
 Bcl I        2    Ecl136 I     2    Nae I        -    SnaB I       1    
 Bcn I        9    Eco47 III    1    Nar I        -    Spe I        1    
 Bgl I        5    Eco57 I      4    Nci I        9    Sph I        1    
 Bgl II       1    EcoN I       1    Nco I        2    Spl I        1    
 Bsa I        1    EcoO109 I    4    Nde I        6    Sse8337 I    -    
 BsaA I       1    EcoR I       2    Nhe I        -    Ssp I        3    
 BsaB I       1    EcoR II     10    Nla III     23    Stu I        -    
 BsaJ I      12    EcoR V       -    Nla IV      20    Sty I        4    
 Bsg I        2    Ehe I        -    Not I        -    Swa I        -    
 BsiE I       5    Esp I        -    Nru I        -    Taq I       13    
 BsiY I      11    Fau I        8    Nsi I        -    Tfi I        4    
 Bsm I        -    Fse I        -    Nsp I        5    Tth111 I     -    
 BsmA I       7    Fnu4H I     22    Nsp7524 I    5    Tth111 II    4    
 Bsp120 I     1    Fok I        7    NspB II      5    Xba I        2    
 Bsp1286 I    6    Fsp I        1    NspC I       5    Xca I        -    
 BspE I       -    Gdi II       3    Pac I        -    Xcm I        -    
 BspH I       5    Gsu I        2    PaeR7 I      1    Xho I        1    
 BspM I       -    Hae I        4    PflM I       1    Xma I        1    
 BspW I      21    Hae II       4    Ple I        6    Xmn I        1    
 Bsr I       10    Hae III     20    



Sequence :


1                                                                              80                                       
CTCGAGGAGCTTGGCCCATTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACC
GCCATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGT
TCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACG
TATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGCTAAACTGCCCACTTGGC
AGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCC
AGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTT
TGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAG
TTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGC
GTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTT
GACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCGAATTCATATGTCTAGATTAGATAAAAGTAAAGTGA
TTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTTGGTGTA
GAGCAGCCTACACTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCA
CCATACTCACTTTTGCCCTTTAAAAGGGGAAAGCTGGCAAGATTTTTTACGCAATAACGCTAAAAGTTTTAGATGTGCTT
TACTAAGTCATCGCAATGGAGCAAAAGTACATTCAGATACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAA
TTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAACGCGTTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGG
TTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTAT
TACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGA
TTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGCGTACAGCCGCGCGCGTACGAAAAACAATTACGGGTCTACCATCGA
GGGCCTGCTCGATCTCCCGGACGACGACGCCCCCGAAGAGGCGGGGCTGGCGGCTCCGCGCCTGTCCTTTCTCCCCGCGG
GACACACGCGCAGACTGTCGACGGCCCCCCCGACCGATGTCAGCCTGGGGGACGAGCTCCACTTAGACGGCGAGGACGTG
GCGATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGACATGTTGGGGGACGGGGATTCCCCGGGTCCGGGATTTAC
CCCCCACGACTCCGCCCCCTACGGCGCTCTGGATATGGCCGACTTCGAGTTTGAGCAGATGTTTACCGATGCCCTTGGAA
TTGACGAGTACGGTGGGTAGGGGGCGCGAGGATCCTCTAGACTGAGAACTTCAGGGTGAGTTTGGGGACCCTTGATTGTT
CTTTCTTTTTCGCTATTGAAAAATTCATGTTATATGGAGGGGGCAAAGTTTTCAGGGTGTTGTTTAGAATGGGAAGATGT
CCCTTGTATCACCATGGACCCTCATGATAATTTTGTTTCTTTCACTTTCTACTCTGTTGACAACCATTGTCTCCTCTTAT
TTTCTTTTCATTTTCTGTAACTTTTTTCGTTAAACTTTAGCTTGCATTTGTAACGAATTTTTAAATTCACTTTCGTTTAT
TTGTCAGATTGTAAGTACTTTCTCTAATCACTTTTTTTTCAAGGCAATCAGGGTAATTATATTGTACTTCAGCACAGTTT
TAGAGAACAATTGTTATAATTAAATGATAAGGTAGAATATTTCTGCATATAAATTCTGGCTGGCGTGGAAATATTCTTAT
TGGTAGAAACAACTACATCCTGGTAATCATCCTGCCTTTCTCTTTATGGTTACAATGATATACACTGTTTGAGATGAGGA
TAAAATACTCTGAGTCCAAACCGGGCCCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCTGGGCAAC
GTGCTGGTTGTTGTGCTGTCTCATCATTTTGGCAAAGAATTCACTCCTCAGGTGCAGGCTGCCTATCAGAAGGTGGTGGC
TGGTGTGGCCAATGCCCTGGCTCACAAATACCACTGAGATCTTTTTCCCTCTGCCAAAAATTATGGGGACATCATGAAGC
CCCTTGAGCATCTGACTTCTGGGTAATAAAGGAAATTTATTTTCATTGCAATAGTGTGTGGGAATTTTTTGTGTCTCTCA
CTCGGAAGGACATATGGGAGGGCAAATCATTTAAAACATCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCAT
ATGCTGGCTGCCATGAACAAAGGTGGCTATAAAGAGGTCATCAGTATATGAAACAGCCCCCTGCTGTCCATTCCTTATTC
CATAGAAAAGCCTTGACTTGAGGTTAGATTTTTTTTATATTTTGTTTTGTGTTATTTTTTTCTTTAACATCCCTAAAATT
TTCCTTACATGTTTTACTAGCCAGATTTTTCCTCCTCTCCTGACTACTCCCAGTCATAGCTGTCCCTCTTCTCTTATGAA
CTCGACTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACT
GACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATC
AGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGT
TTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTA
TAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTC
CGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCT
CCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAAC
CCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTAC
AGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTA
CCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAG
CAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAA
CTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTA
AATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATC
TGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCC
CAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCG
AGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCG
CCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATT
CAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTC
CGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATG
CCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTG
CTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTT
CGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCA
GCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGAC
ACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGAT
ACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAA
GAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC