Logo ZMBH Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name: pUHD 15-20     Size:             3872 bp


Resistance:   Ampicillin     constructed by: Manfred Gossen


Host strain:  XL1 blue, DH5 alpha, E.coli "SURE"


Reference:    Manfred Gossen unpublished


Plasmid - Map:

Plasmid-Map of pUHD15-20

Description :

The plasmid consists of three main fragments:

  1. pBR322-sequences including
  2. The regulatory region with
  3. The tTA-gene

Restriction sites :

Absent sites :


Afl II    c/ttaag          Dra III   cacnnn/gtg       Pml I     cac/gtg          
Age I     a/ccggt          Eag I     c/ggccg          Sap I     gcttcttc  1/4    
Apa I     gggcc/c          EcoR V    gat/atc          Sfi I     ggccnnnn/nggcc   
Asp718    g/gtacc          Esp I     gc/tnagc         SgrA I    cr/ccggyg        
Avr II    c/ctagg          Fse I     ggccgg/cc        Sna I     gta/tac          
Bgl II    a/gatct          Kpn I     ggtac/c          Spe I     a/ctagt          
Bsp120 I  g/ggccc          Msc I     tgg/cca          Sse8337 I cctgca/gg        
BspE I    t/ccgga          Nco I     c/catgg          Stu I     agg/cct          
BspM I    acctgc    4/8    Nhe I     g/ctagc          Swa I     attt/aaat        
BstX I    ccannnnn/ntgg    Not I     gc/ggccgc        Tth111 I  gacn/nngtc       
Bsu36 I   cc/tnagg         Pac I     ttaat/taa        Xca I     gta/tac          
Cla I     at/cgat          PflM I    ccannnn/ntgg     Xcm I     ccannnnn/nnnntgg 
          

Unique sites:


Enzyme                       Position

PaeR7 I   c/tcgag                1
Xho I     c/tcgag                1
BstB I    tt/cgaa               41
Rsr II    cg/gwccg              71
Mlu I     a/cgcgt              102
Pst I     ctgca/g              131
EcoN I    cctnn/nnnagg         391
BsaA I    yac/gtr              422
SnaB I    tac/gta              422
Nru I     tcg/cga              465
Nsi I     atgca/t              572
Eco47 III agc/gct              589
Bsg I     gtgcag   16/14       728
Spl I     c/gtacg              823
Dsa I     c/crygg              929
Sac II    ccgc/gg              929
Sal I     g/tcgac              951 
PshA I    gacnn/nngtc          966
Ban II    grgcy/c              988
Ecl136 I  gag/ctc              988
Sac I     gagct/c              988
Sph I     gcatg/c             1023
Sma I     ccc/ggg             1077
Xma I     c/ccggg             1077
BamH I    g/gatcc             1204
Hpa I     gtt/aac             1337
PpuM I    rg/gwccy            1487
Bbe I     ggcgc/c             1545
Ehe I     ggc/gcc             1545
Kas I     g/gcgcc             1545
Nar I     gg/cgcc             1545
BstE II   g/gtnacc            1577
Nae I     gcc/ggc             1621
Hind III  a/agctt             1662
Pvu II    cag/ctg             1810
Drd I     gacnnnn/nngtc       2090
AlwN I    cagnnn/ctg          2399
Bsa I     ggtctc    1/5       2948
Gsu I     ctggag   16/14      2966
Fsp I     tgc/gca             3101
Pvu I     cgat/cg             3248
Sca I     agt/act             3359
Xmn I     gaann/nnttc         3476
Ssp I     aat/att             3683
Aat II    gacgt/c             3799
Bbs I     gaagac    2/6       3866


Multiple sites:


Enzyme                    Sites    Positions:

Acc I     gt/mkac          2     843      951
ApaL I    g/tgcac          2    2302     3548
Ase I     at/taat          2    1817     3052
Bcl I     t/gatca          2     717      761
Bgl I     gccnnnn/nggc     2    1523     2995
BsaB I    gatnn/nnatc      2    1042     1436
BsmA I    gtctc     1/5    2    2948     3713
EcoR I    g/aattc          2      38      179
Nde I     ca/tatg          2     184      765
Sty I     c/cwwgg          2     723     1167
Xba I     t/ctaga          2     175      190

Afl III   a/crygt          3     102     1055     1988
Ava I     c/ycgrg          3       1     1077     1538
Ban I     g/gyrcc          3     371     1545     2829
BspH I    t/catga          3    2708     3716     3821
BssH II   g/cgcgc          3     818     1499     1602
Cfr10 I   r/ccggy          3    1581     1621     2961
Eco57 I   ctgaag   16/14   3    1611     2515     3563
EcoO109 I rg/gnccy         3     854     1487     3856
Fok I     ggatg     9/13   3    2861     3042     3329
Mme I     tccrac   20/18   3     244     2178     2362
Tth111 II caarca   11/9    3    2562     2595     2601

Site Usage:


 Aat II       1    BssH II      3    Hga I       10    Pml I        -    
 Acc I        2    BstB I       1    HgiA I       4    PpuM I       1    
 Afl II       -    BstE II      1    Hha I       29    PshA I       1    
 Afl III      3    BstK I      14    Hinc II      4    Pst I        1    
 Age I        -    BstN I       6    Hind III     1    Pvu I        1    
 Aha II       5    BstU I      23    Hinf I       9    Pvu II       1    
 Alu I       18    BstX I       -    HinP I      29    Rma I        9    
 Alw I       13    BstY I       9    Hpa I        1    Rsa I        7    
 AlwN I       1    Bsu36 I      -    Hpa II      17    Rsr II       1    
 Apa I        -    Cfr10 I      3    Hph I        7    Sac I        1    
 ApaL I       2    Cla I        -    Kas I        1    Sac II       1    
 Ase I        2    Csp6 I       7    Kpn I        -    Sal I        1    
 Asp718       -    Dde I       10    Mae II       6    Sap I        -    
 Ava I        3    Dpn I       22    Mae III     11    Sau3A I     22    
 Ava II       8    Dpn II      22    Mbo I       22    Sau96 I     14    
 Avr II       -    Dra I        4    Mbo II      11    Sca I        1    
 BamH I       1    Dra III      -    Mcr I        5    ScrF I      14    
 Ban I        3    Drd I        1    Mlu I        1    SfaN I      10    
 Ban II       1    Dsa I        1    Mme I        3    Sfe I        5    
 Bbe I        1    Dsa V       14    Mnl I       25    Sfi I        -    
 Bbs I        1    Eae I        4    Msc I        -    SgrA I       -    
 Bbv I       13    Eag I        -    Mse I       18    Sma I        1    
 BceF I       5    Ear I        4    Msp I       17    Sna I        -    
 Bcl I        2    Ecl136 I     1    Nae I        1    SnaB I       1    
 Bcn I        8    Eco47 III    1    Nar I        1    Spe I        -    
 Bgl I        2    Eco57 I      3    Nci I        8    Sph I        1    
 Bgl II       -    EcoN I       1    Nco I        -    Spl I        1    
 Bsa I        1    EcoO109 I    3    Nde I        2    Sse8337 I    -    
 BsaA I       1    EcoR I       2    Nhe I        -    Ssp I        1    
 BsaB I       2    EcoR II      6    Nla III     14    Stu I        -    
 BsaJ I      11    EcoR V       -    Nla IV      16    Sty I        2    
 Bsg I        1    Ehe I        1    Not I        -    Swa I        -    
 BsiE I       5    Esp I        -    Nru I        1    Taq I       15    
 BsiY I       9    Fau I        8    Nsi I        1    Tfi I        4    
 Bsm I        4    Fse I        -    Nsp I        5    Tth111 I     -    
 BsmA I       2    Fnu4H I     26    Nsp7524 I    5    Tth111 II    3    
 Bsp120 I     -    Fok I        3    NspB II      5    Xba I        2    
 Bsp1286 I    4    Fsp I        1    NspC I       5    Xca I        -    
 BspE I       -    Gdi II       4    Pac I        -    Xcm I        -    
 BspH I       3    Gsu I        1    PaeR7 I      1    Xho I        1    
 BspM I       -    Hae I        4    PflM I       -    Xma I        1    
 BspW I      18    Hae II       6    Ple I        5    Xmn I        1    
 Bsr I        9    Hae III     18    



Sequence :


1                                                                              80                                       
CTCGAGATCCGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGG
TCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAG
CGTGCCGCAGATCCTCTAGAATTCATATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAAT
GAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGT
AAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAG
GGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAA
GTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTT
TTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATC
AAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGAT
CACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAG
TGGGTCCGCGTACAGCCGCGCGCGTACGAAAAACAATTACGGGTCTACCATCGAGGGCCTGCTCGATCTCCCGGACGACG
ACGCCCCCGAAGAGGCGGGGCTGGCGGCTCCGCGCCTGTCCTTTCTCCCCGCGGGACACACGCGCAGACTGTCGACGGCC
CCCCCGACCGATGTCAGCCTGGGGGACGAGCTCCACTTAGACGGCGAGGACGTGGCGATGGCGCATGCCGACGCGCTAGA
CGATTTCGATCTGGACATGTTGGGGGACGGGGATTCCCCGGGTCCGGGATTTACCCCCCACGACTCCGCCCCCTACGGCG
CTCTGGATATGGCCGACTTCGAGTTTGAGCAGATGTTTACCGATGCCCTTGGAATTGACGAGTACGGTGGGTAGGGGGCG
CGAGGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTT
GTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCAT
TTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTA
TGATCCTGCAAGCCTCGTCGTCTGGCCGGACCACGCTATCTGTGCAAGGTCCCCGGACGCGCGCTCCATGAGCAGAGCGC
CCGCCGCCGAGGCAAGACTCGGGCGGCGCCCTGCCCGTCCCACCAGGTCAACAGGCGGTAACCGGCCTCTTCATCGGGAA
TGCGCGCGACCTTCAGCATCGCCGGCATGTCCCCTGGCGGACGGGAAGTATCAGCTCGACCAAGCTTGGCGAGATTTTCA
GGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACA
TTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGCTGCATTAATGAATCGGCCAACGCGCGG
GGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGA
GCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAA
AGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATC
ACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCC
CTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTC
TCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTC
AGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCA
GCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTA
CACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCG
GCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAA
GATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC
AAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGT
CTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTC
CCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTC
ACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCT
CCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATT
GCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTAC
ATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGT
TATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAG
TACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGC
GCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGT
TGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGA
GCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTT
TCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAA
TAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAA
AATAGGCGTATCACGAGGCCCTTTCGTCTTCA