Logo ZMBH-Abteilung Prof. Dr. Hermann Bujard

Plasmid Data Sheet

 
Plasmid name: pUHD 15-1        Size:            4455 bp


Resistance:   Ampicillin       constructed by: Manfred Gossen


Host strains: XL1 blue, DH5 alpha, E.coli "SURE"


Reference:    Gossen M. and Bujard H. (1992); PNAS, 89, 5547-51


Plasmid - Map:

Plasmid-Map of pUHD15-1

Description :

The plasmid consists of three main fragments:

  1. pBR322-sequences including
  2. The regulatory region with
  3. The tTA-gene

Restriction sites :

Absent sites :

Afl II    c/ttaag          Dra III   cacnnn/gtg       Pst I     ctgca/g          
Age I     a/ccggt          Eag I     c/ggccg          Rsr II    cg/gwccg         
Apa I     gggcc/c          EcoR V    gat/atc          Sap I     gcttcttc  1/4    
Asp718    g/gtacc          Esp I     gc/tnagc         Sfi I     ggccnnnn/nggcc   
Avr II    c/ctagg          Fse I     ggccgg/cc        SgrA I    cr/ccggyg        
Bgl II    a/gatct          Kpn I     ggtac/c          Sna I     gta/tac          
Bsp120 I  g/ggccc          Mlu I     a/cgcgt          Sse8337 I cctgca/gg        
BspE I    t/ccgga          Msc I     tgg/cca          Stu I     agg/cct          
BspM I    acctgc    4/8    Nhe I     g/ctagc          Swa I     attt/aaat        
BstB I    tt/cgaa          Not I     gc/ggccgc        Tth111 I  gacn/nngtc       
BstX I    ccannnnn/ntgg    Pac I     ttaat/taa        Xca I     gta/tac          
Bsu36 I   cc/tnagg         PflM I    ccannnn/ntgg     Xcm I     ccannnnn/nnnntgg 
Cla I     at/cgat          Pml I     cac/gtg

          

Unique sites:


Enzyme                        Position

PaeR7 I   c/tcgag                1
Xho I     c/tcgag                1
Spe I     a/ctagt              103
Nco I     c/catgg              464
Bbs I     gaagac    2/6        731
EcoR I    g/aattc              766
Xba I     t/ctaga              777
EcoN I    cctnn/nnnagg         978
Nru I     tcg/cga             1052
Nsi I     atgca/t             1159
Eco47 III agc/gct             1176
Bsg I     gtgcag   16/14      1315
Spl I     c/gtacg             1410
Sal I     g/tcgac             1538
PshA I    gacnn/nngtc         1553
Sph I     gcatg/c             1610
Sma I     ccc/ggg             1664
Xma I     c/ccggg             1664
BamH I    g/gatcc             1791
Hpa I     gtt/aac             1924
PpuM I    rg/gwccy            2074
Bbe I     ggcgc/c             2132
Ehe I     ggc/gcc             2132
Kas I     g/gcgcc             2132
Nar I     gg/cgcc             2132
BstE II   g/gtnacc            2164
Nae I     gcc/ggc             2208
Hind III  a/agctt             2249
Pvu II    cag/ctg             2397
Drd I     gacnnnn/nngtc       2677
AlwN I    cagnnn/ctg          2986
Bsa I     ggtctc    1/5       3535
Fsp I     tgc/gca             3688
Pvu I     cgat/cg             3835
Sca I     agt/act             3946
Xmn I     gaann/nnttc         4063
Ssp I     aat/att             4270

Multiple sites:


Enzyme                    Sites    Positions:

Acc I     gt/mkac          2       1430     1538
Afl III   a/crygt          2       1642     2575
ApaL I    g/tgcac          2       2889     4135
Ban II    grgcy/c          2        668     1575
Bcl I     t/gatca          2       1304     1348
BsaA I    yac/gtr          2        442     1009
BsaB I    gatnn/nnatc      2       1629     2023
Ecl136 I  gag/ctc          2        668     1575
Gsu I     ctggag   16/14   2        696     3553
Sac I     gagct/c          2        668     1575
Sac II    ccgc/gg          2        756     1516
SnaB I    tac/gta          2        442     1009

Ase I     at/taat          3        110     2404     3639
Ava I     c/ycgrg          3          1     1664     2125 
BspH I    t/catga          3       3295     4303     4408
BssH II   g/cgcgc          3       1405     2086     2189
Cfr10 I   r/ccggy          3       2168     2208     3548
Dsa I     c/crygg          3        464      756     1516
Eco57 I   ctgaag   16/14   3       2198     3102     4150
EcoO109 I rg/gnccy         3       1441     2074     4443
Hae I     wgg/ccw          3       2588     2599     3051
Nde I     ca/tatg          3        337      771     1352
Sty I     c/cwwgg          3        464     1310     1754
Tth111 II caarca   11/9    3       3149     3182     3188

Site Usage:


 Aat II       5    BssH II      3    Hga I        9    Pml I        -    
 Acc I        2    BstB I       -    HgiA I       5    PpuM I       1    
 Afl II       -    BstE II      1    Hha I       28    PshA I       1    
 Afl III      2    BstK I      18    Hinc II      4    Pst I        -    
 Age I        -    BstN I       9    Hind III     1    Pvu I        1    
 Aha II      10    BstU I      23    Hinf I      10    Pvu II       1    
 Alu I       20    BstX I       -    HinP I      28    Rma I        9    
 Alw I       12    BstY I       7    Hpa I        1    Rsa I       14    
 AlwN I       1    Bsu36 I      -    Hpa II      17    Rsr II       -    
 Apa I        -    Cfr10 I      3    Hph I        7    Sac I        2    
 ApaL I       2    Cla I        -    Kas I        1    Sac II       2    
 Ase I        3    Csp6 I      14    Kpn I        -    Sal I        1    
 Asp718       -    Dde I       10    Mae II      13    Sap I        -    
 Ava I        3    Dpn I       22    Mae III     13    Sau3A I     22    
 Ava II       7    Dpn II      22    Mbo I       22    Sau96 I     16    
 Avr II       -    Dra I        4    Mbo II      11    Sca I        1    
 BamH I       1    Dra III      -    Mcr I        5    ScrF I      18    
 Ban I        4    Drd I        1    Mlu I        -    SfaN I      10    
 Ban II       2    Dsa I        3    Mme I        4    Sfe I        4    
 Bbe I        1    Dsa V       18    Mnl I       27    Sfi I        -    
 Bbs I        1    Eae I        4    Msc I        -    SgrA I       -    
 Bbv I       12    Eag I        -    Mse I       17    Sma I        1    
 BceF I       5    Ear I        4    Msp I       17    Sna I        -    
 Bcl I        2    Ecl136 I     2    Nae I        1    SnaB I       2    
 Bcn I        9    Eco47 III    1    Nar I        1    Spe I        1    
 Bgl I        6    Eco57 I      3    Nci I        9    Sph I        1    
 Bgl II       -    EcoN I       1    Nco I        1    Spl I        1    
 Bsa I        1    EcoO109 I    3    Nde I        3    Sse8337 I    -    
 BsaA I       2    EcoR I       1    Nhe I        -    Ssp I        1    
 BsaB I       2    EcoR II      9    Nla III     18    Stu I        -    
 BsaJ I      12    EcoR V       -    Nla IV      18    Sty I        3    
 Bsg I        1    Ehe I        1    Not I        -    Swa I        -    
 BsiE I       5    Esp I        -    Nru I        1    Taq I       13    
 BsiY I      10    Fau I        9    Nsi I        1    Tfi I        4    
 Bsm I        4    Fse I        -    Nsp I        5    Tth111 I     -    
 BsmA I       4    Fnu4H I     24    Nsp7524 I    5    Tth111 II    3    
 Bsp120 I     -    Fok I        4    NspB II      6    Xba I        1    
 Bsp1286 I    5    Fsp I        1    NspC I       5    Xca I        -    
 BspE I       -    Gdi II       4    Pac I        -    Xcm I        -    
 BspH I       3    Gsu I        2    PaeR7 I      1    Xho I        1    
 BspM I       -    Hae I        3    PflM I       -    Xma I        1    
 BspW I      24    Hae II       6    Ple I        6    Xmn I        1    
 Bsr I       10    Hae III     20    


Sequence :


1                                                                              80                                       CTCGAGGAGCTTGGCCCATTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACC
CTCGAGGAGCTTGGCCCATTGCATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACC
GCCATGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGT
TCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACG
TATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGCTAAACTGCCCACTTGGC
AGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCC
AGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTT
TGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAG
TTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGC
GTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTT
GACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGAATTCATATGTCTAGATTAGATAAAAGTAAAGTG
ATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGCTAGGTGT
AGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGC
ACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAACGCTAAAAGTTTTAGATGTGCT
TTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCA
ATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCAGCGCTGTGGGGCATTTTACTTTAG
GTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCATTA
TTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTTCTTATTCGGCCTTGAATTGATCATATGCGG
ATTAGAAAAACAACTTAAATGTGAAAGTGGGTCCGCGTACAGCCGCGCGCGTACGAAAAACAATTACGGGTCTACCATCG
AGGGCCTGCTCGATCTCCCGGACGACGACGCCCCCGAAGAGGCGGGGCTGGCGGCTCCGCGCCTGTCCTTTCTCCCCGCG
GGACACACGCGCAGACTGTCGACGGCCCCCCCGACCGATGTCAGCCTGGGGGACGAGCTCCACTTAGACGGCGAGGACGT
GGCGATGGCGCATGCCGACGCGCTAGACGATTTCGATCTGGACATGTTGGGGGACGGGGATTCCCCGGGTCCGGGATTTA
CCCCCCACGACTCCGCCCCCTACGGCGCTCTGGATATGGCCGACTTCGAGTTTGAGCAGATGTTTACCGATGCCCTTGGA
ATTGACGAGTACGGTGGGTAGGGGGCGCGAGGATCCAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTA
GAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAA
CAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAA
CCTCTACAAATGTGGTATGGCTGATTATGATCCTGCAAGCCTCGTCGTCTGGCCGGACCACGCTATCTGTGCAAGGTCCC
CGGACGCGCGCTCCATGAGCAGAGCGCCCGCCGCCGAGGCAAGACTCGGGCGGCGCCCTGCCCGTCCCACCAGGTCAACA
GGCGGTAACCGGCCTCTTCATCGGGAATGCGCGCGACCTTCAGCATCGCCGGCATGTCCCCTGGCGGACGGGAAGTATCA
GCTCGACCAAGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCACTGGATATACCACCGTTGA
TATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCAGACCGTTCAGC
TGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCG
CTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGA
TAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCC
ATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGA
TACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTT
TCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGC
TGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTA
AGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTT
CTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCG
GAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATT
ACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACG
TTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAA
TCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTA
TTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGC
TGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCA
GAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTT
AATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTC
CGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCG
TTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCC
GTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTG
CCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGC
GAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCT
TTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAA
ATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATAT
TTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACC
ATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC